EMAIL THIS PAGE TO A FRIEND

KDELC1

KDEL (Lys-Asp-Glu-Leu) containing 1

57 Gene Product Result for
Synonyms: EP58 KDEL1
UniProtKB ID: Q6UW63, Q53HL3, Q9BVD2
Gene ID:
Human(79070) Summary: This gene encodes a protein product localized to the lumen of the endoplasmic reticulum. As a member of the endoplasmic reticulum protein family the encoded protein contains a Lys-Asp-Glu-Leu or KDEL motif located at the extreme C-terminus which prevents all endoplasmic reticulum resident proteins from being secreted. Proteins carrying this motif are bound by a receptor in the Golgi apparatus so that the receptor-ligand complex returns to the endoplasmic reticulum. A processed non-transcribed pseudogene located in an intron of a sodium transporter gene on chromosome 5 has been defined for this gene. [provided by RefSeq, Jul 2008]
Mouse(72050) KDEL (Lys-Asp-Glu-Leu) containing 1
Rat(316370) KDEL (Lys-Asp-Glu-Leu) containing 1
Zebrafish(393905) KDEL (Lys-Asp-Glu-Leu) containing 1
chicken(418766) KDEL (Lys-Asp-Glu-Leu) containing 1
domestic cat(101082874) KDEL (Lys-Asp-Glu-Leu) containing 1
Horse(100051191) KDEL (Lys-Asp-Glu-Leu) containing 1
dog(476980) KDEL (Lys-Asp-Glu-Leu) containing 1
cow(514810) KDEL (Lys-Asp-Glu-Leu) containing 1
domestic guinea pig(100720008) KDEL (Lys-Asp-Glu-Leu) containing 1
naked mole-rat(101698159) KDEL (Lys-Asp-Glu-Leu) containing 1
sheep(101114030) KDEL (Lys-Asp-Glu-Leu) containing 1
Domestic Rabbit(100337895) KDEL (Lys-Asp-Glu-Leu) containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024089 Rosetta Predictions human pricing
NM_001108217 Rosetta Predictions rat pricing
NM_023645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113044 predicted 1848
2 SASI_Hs01_00113045 predicted 1501
3 SASI_Hs01_00113047 predicted 1522
4 SASI_Hs01_00113048 predicted 1334
5 SASI_Hs01_00113049 predicted 1190
6 SASI_Hs01_00113050 predicted 1035
7 SASI_Hs01_00113052 predicted 1419
8 SASI_Hs02_00356564 predicted 388
9 SASI_Hs01_00113053 predicted 1215
10 SASI_Hs02_00356565 predicted 1070
11 SASI_Hs01_00113046 predicted 1725
12 SASI_Hs01_00113051 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236474 predicted 1000
2 SASI_Rn02_00236475 predicted 1063
3 SASI_Rn02_00236476 predicted 878
4 SASI_Rn02_00236477 predicted 756
5 SASI_Rn02_00236478 predicted 732
6 SASI_Rn02_00236479 predicted 701
7 SASI_Rn02_00236480 predicted 599
8 SASI_Rn02_00236481 predicted 1321
9 SASI_Rn02_00236482 predicted 1300
10 SASI_Rn02_00236483 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135583 predicted 858
2 SASI_Mm01_00135584 predicted 516
3 SASI_Mm01_00135585 predicted 1309
4 SASI_Mm01_00135586 predicted 1111
5 SASI_Mm01_00135588 predicted 1009
6 SASI_Mm01_00135589 predicted 1105
7 SASI_Mm01_00135590 predicted 879
8 SASI_Mm01_00135591 predicted 1218
9 SASI_Mm01_00135592 predicted 998
10 SASI_Mm02_00327258 predicted 837
11 SASI_Mm01_00135587 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024089
VALIDATED
KDELC1 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) containing 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024089.2-467s21c1
Sequence:CCGGGCCCGGAGAAGAGCGAAATATCTCGAGATATTTCGCTCTTCTCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024089.1-500s1c1
Sequence:CCGGGTGGATACATCAGGGAATAAACTCGAGTTTATTCCCTGATGTATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1140s1c1
Sequence:CCGGCTACGTACGATTTGACTGATTCTCGAGAATCAGTCAAATCGTACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1139s1c1
Sequence:CCGGCCTACGTACGATTTGACTGATCTCGAGATCAGTCAAATCGTACGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024089.1-1876s1c1
Sequence:CCGGGTGCTCTGAAGACTCTTCTTACTCGAGTAAGAAGAGTCTTCAGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1805s1c1
Sequence:CCGGCCTTGTACTTGCCATAGGAAACTCGAGTTTCCTATGGCAAGTACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-797s1c1
Sequence:CCGGCCTGAAACCATTGCTCAGATTCTCGAGAATCTGAGCAATGGTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1110s1c1
Sequence:CCGGGCTCCACAGATTCCAAGGATACTCGAGTATCCTTGGAATCTGTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024089.2-1852s21c1
Sequence:CCGGCCTTGTACTTGCCATAGGAAACTCGAGTTTCCTATGGCAAGTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024089.2-1923s21c1
Sequence:CCGGGTGCTCTGAAGACTCTTCTTACTCGAGTAAGAAGAGTCTTCAGAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024089.2-844s21c1
Sequence:CCGGCCTGAAACCATTGCTCAGATTCTCGAGAATCTGAGCAATGGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-796s1c1
Sequence:CCGGCCCTGAAACCATTGCTCAGATCTCGAGATCTGAGCAATGGTTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024089.1-900s1c1
Sequence:CCGGGCCTATGTCACTACACCTTAACTCGAGTTAAGGTGTAGTGACATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-983s1c1
Sequence:CCGGGCCATACTACTTTCTTTGACTCTCGAGAGTCAAAGAAAGTAGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1291s1c1
Sequence:CCGGGCTGGTTAAACTCAGTAGAAACTCGAGTTTCTACTGAGTTTAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024089
VALIDATED
KDELC1 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) containing 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024089.2-467s21c1
Sequence:CCGGGCCCGGAGAAGAGCGAAATATCTCGAGATATTTCGCTCTTCTCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024089.1-500s1c1
Sequence:CCGGGTGGATACATCAGGGAATAAACTCGAGTTTATTCCCTGATGTATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1140s1c1
Sequence:CCGGCTACGTACGATTTGACTGATTCTCGAGAATCAGTCAAATCGTACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1139s1c1
Sequence:CCGGCCTACGTACGATTTGACTGATCTCGAGATCAGTCAAATCGTACGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024089.1-1876s1c1
Sequence:CCGGGTGCTCTGAAGACTCTTCTTACTCGAGTAAGAAGAGTCTTCAGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1805s1c1
Sequence:CCGGCCTTGTACTTGCCATAGGAAACTCGAGTTTCCTATGGCAAGTACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-797s1c1
Sequence:CCGGCCTGAAACCATTGCTCAGATTCTCGAGAATCTGAGCAATGGTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1110s1c1
Sequence:CCGGGCTCCACAGATTCCAAGGATACTCGAGTATCCTTGGAATCTGTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024089.2-1852s21c1
Sequence:CCGGCCTTGTACTTGCCATAGGAAACTCGAGTTTCCTATGGCAAGTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024089.2-1923s21c1
Sequence:CCGGGTGCTCTGAAGACTCTTCTTACTCGAGTAAGAAGAGTCTTCAGAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024089.2-844s21c1
Sequence:CCGGCCTGAAACCATTGCTCAGATTCTCGAGAATCTGAGCAATGGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-796s1c1
Sequence:CCGGCCCTGAAACCATTGCTCAGATCTCGAGATCTGAGCAATGGTTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024089.1-900s1c1
Sequence:CCGGGCCTATGTCACTACACCTTAACTCGAGTTAAGGTGTAGTGACATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-983s1c1
Sequence:CCGGGCCATACTACTTTCTTTGACTCTCGAGAGTCAAAGAAAGTAGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1291s1c1
Sequence:CCGGGCTGGTTAAACTCAGTAGAAACTCGAGTTTCTACTGAGTTTAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024089
VALIDATED
KDELC1 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) containing 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024089.2-467s21c1
Sequence:CCGGGCCCGGAGAAGAGCGAAATATCTCGAGATATTTCGCTCTTCTCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024089.1-500s1c1
Sequence:CCGGGTGGATACATCAGGGAATAAACTCGAGTTTATTCCCTGATGTATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1140s1c1
Sequence:CCGGCTACGTACGATTTGACTGATTCTCGAGAATCAGTCAAATCGTACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1139s1c1
Sequence:CCGGCCTACGTACGATTTGACTGATCTCGAGATCAGTCAAATCGTACGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024089.1-1876s1c1
Sequence:CCGGGTGCTCTGAAGACTCTTCTTACTCGAGTAAGAAGAGTCTTCAGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1805s1c1
Sequence:CCGGCCTTGTACTTGCCATAGGAAACTCGAGTTTCCTATGGCAAGTACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-797s1c1
Sequence:CCGGCCTGAAACCATTGCTCAGATTCTCGAGAATCTGAGCAATGGTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1110s1c1
Sequence:CCGGGCTCCACAGATTCCAAGGATACTCGAGTATCCTTGGAATCTGTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024089.2-1852s21c1
Sequence:CCGGCCTTGTACTTGCCATAGGAAACTCGAGTTTCCTATGGCAAGTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024089.2-1923s21c1
Sequence:CCGGGTGCTCTGAAGACTCTTCTTACTCGAGTAAGAAGAGTCTTCAGAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024089.2-844s21c1
Sequence:CCGGCCTGAAACCATTGCTCAGATTCTCGAGAATCTGAGCAATGGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-796s1c1
Sequence:CCGGCCCTGAAACCATTGCTCAGATCTCGAGATCTGAGCAATGGTTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024089.1-900s1c1
Sequence:CCGGGCCTATGTCACTACACCTTAACTCGAGTTAAGGTGTAGTGACATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-983s1c1
Sequence:CCGGGCCATACTACTTTCTTTGACTCTCGAGAGTCAAAGAAAGTAGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024089.1-1291s1c1
Sequence:CCGGGCTGGTTAAACTCAGTAGAAACTCGAGTTTCTACTGAGTTTAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023645
VALIDATED
KDELC1 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1320s21c1
Sequence:CCGGCCATCGTGAAACACATTTCATCTCGAGATGAAATGTGTTTCACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1589s21c1
Sequence:CCGGGGACAAGAATTTGCGAGAAATCTCGAGATTTCTCGCAAATTCTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-356s21c1
Sequence:CCGGAGCCCAGAGAAGAGCGAAATACTCGAGTATTTCGCTCTTCTCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1896s21c1
Sequence:CCGGTCTCACAGTATTTCGTCTTATCTCGAGATAAGACGAAATACTGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-837s21c1
Sequence:CCGGGCCTGTGTCACTATACCTTAACTCGAGTTAAGGTATAGTGACACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-1321s1c1
Sequence:CCGGCCATCGTGAAACACATTTCATCTCGAGATGAAATGTGTTTCACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-838s1c1
Sequence:CCGGGCCTGTGTCACTATACCTTAACTCGAGTTAAGGTATAGTGACACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023645.2-2018s1c1
Sequence:CCGGGCAGAAGAAATAGGCGAGTTTCTCGAGAAACTCGCCTATTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-358s1c1
Sequence:CCGGGCCCAGAGAAGAGCGAAATATCTCGAGATATTTCGCTCTTCTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023645.2-1060s1c1
Sequence:CCGGCCAGGGATATTGTGATGCCTACTCGAGTAGGCATCACAATATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023645
VALIDATED
KDELC1 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1320s21c1
Sequence:CCGGCCATCGTGAAACACATTTCATCTCGAGATGAAATGTGTTTCACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1589s21c1
Sequence:CCGGGGACAAGAATTTGCGAGAAATCTCGAGATTTCTCGCAAATTCTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-356s21c1
Sequence:CCGGAGCCCAGAGAAGAGCGAAATACTCGAGTATTTCGCTCTTCTCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1896s21c1
Sequence:CCGGTCTCACAGTATTTCGTCTTATCTCGAGATAAGACGAAATACTGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-837s21c1
Sequence:CCGGGCCTGTGTCACTATACCTTAACTCGAGTTAAGGTATAGTGACACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-1321s1c1
Sequence:CCGGCCATCGTGAAACACATTTCATCTCGAGATGAAATGTGTTTCACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-838s1c1
Sequence:CCGGGCCTGTGTCACTATACCTTAACTCGAGTTAAGGTATAGTGACACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023645.2-2018s1c1
Sequence:CCGGGCAGAAGAAATAGGCGAGTTTCTCGAGAAACTCGCCTATTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-358s1c1
Sequence:CCGGGCCCAGAGAAGAGCGAAATATCTCGAGATATTTCGCTCTTCTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023645.2-1060s1c1
Sequence:CCGGCCAGGGATATTGTGATGCCTACTCGAGTAGGCATCACAATATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023645
VALIDATED
KDELC1 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1320s21c1
Sequence:CCGGCCATCGTGAAACACATTTCATCTCGAGATGAAATGTGTTTCACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1589s21c1
Sequence:CCGGGGACAAGAATTTGCGAGAAATCTCGAGATTTCTCGCAAATTCTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-356s21c1
Sequence:CCGGAGCCCAGAGAAGAGCGAAATACTCGAGTATTTCGCTCTTCTCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-1896s21c1
Sequence:CCGGTCTCACAGTATTTCGTCTTATCTCGAGATAAGACGAAATACTGTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023645.3-837s21c1
Sequence:CCGGGCCTGTGTCACTATACCTTAACTCGAGTTAAGGTATAGTGACACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-1321s1c1
Sequence:CCGGCCATCGTGAAACACATTTCATCTCGAGATGAAATGTGTTTCACGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-838s1c1
Sequence:CCGGGCCTGTGTCACTATACCTTAACTCGAGTTAAGGTATAGTGACACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023645.2-2018s1c1
Sequence:CCGGGCAGAAGAAATAGGCGAGTTTCTCGAGAAACTCGCCTATTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023645.2-358s1c1
Sequence:CCGGGCCCAGAGAAGAGCGAAATATCTCGAGATATTTCGCTCTTCTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023645.2-1060s1c1
Sequence:CCGGCCAGGGATATTGTGATGCCTACTCGAGTAGGCATCACAATATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)