EMAIL THIS PAGE TO A FRIEND

KDELC2

KDEL (Lys-Asp-Glu-Leu) containing 2

109 Gene Product Result for
UniProtKB ID: Q7Z4H8, Q6UWW2, Q6ZUM9, Q8N7L8, Q8NE24
Gene ID:
Mouse(68304) KDEL (Lys-Asp-Glu-Leu) containing 2
Rat(315664) KDEL (Lys-Asp-Glu-Leu) containing 2
Zebrafish(566063) KDEL (Lys-Asp-Glu-Leu) containing 2
chicken(418966) KDEL (Lys-Asp-Glu-Leu) containing 2
domestic cat(101099996) KDEL (Lys-Asp-Glu-Leu) containing 2
cow(100298704) KDEL (Lys-Asp-Glu-Leu) containing 2
dog(489419) KDEL (Lys-Asp-Glu-Leu) containing 2
sheep(101105356) KDEL (Lys-Asp-Glu-Leu) containing 2
Domestic Rabbit(100346510) KDEL (Lys-Asp-Glu-Leu) containing 2
domestic guinea pig(100718265) KDEL (Lys-Asp-Glu-Leu) containing 2
naked mole-rat(101719645) KDEL (Lys-Asp-Glu-Leu) containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_110668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153705 Rosetta Predictions human pricing
NM_001025123 Rosetta Predictions rat pricing
NM_212445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228985 predicted 1396
2 SASI_Hs02_00367426 predicted 664
3 SASI_Hs01_00228989 predicted 1249
4 SASI_Hs01_00228991 predicted 1124
5 SASI_Hs02_00367427 predicted 660
6 SASI_Hs01_00228992 predicted 1132
7 SASI_Hs01_00228993 predicted 305
8 SASI_Hs01_00228994 predicted 1196
9 SASI_Hs02_00367428 predicted 399
10 SASI_Hs02_00367429 predicted 292
11 SASI_Hs01_00228986 predicted 1273
12 SASI_Hs01_00228987 predicted 297
13 SASI_Hs01_00228988 predicted 901
14 SASI_Hs01_00228990 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086929 predicted 485
2 SASI_Rn01_00086930 predicted 210
3 SASI_Rn01_00086931 predicted 580
4 SASI_Rn01_00086932 predicted 874
5 SASI_Rn01_00086933 predicted 207
6 SASI_Rn01_00086934 predicted 1552
7 SASI_Rn01_00086935 predicted 1327
8 SASI_Rn01_00086936 predicted 1272
9 SASI_Rn01_00086937 predicted 267
10 SASI_Rn01_00086938 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352260 predicted 1605
2 SASI_Mm01_00134150 predicted 264
3 SASI_Mm01_00134151 predicted 387
4 SASI_Mm01_00134152 predicted 321
5 SASI_Mm01_00134153 predicted 577
6 SASI_Mm01_00134154 predicted 310
7 SASI_Mm01_00134155 predicted 1125
8 SASI_Mm01_00134156 predicted 294
9 SASI_Mm01_00134158 predicted 925
10 SASI_Mm01_00134159 predicted 1380
11 SASI_Mm01_00134157 predicted 1283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110668
KDELC2 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_110668.2-2319s1c1
Sequence:CCGGCCGGCAAGAATTTGTATCTTTCTCGAGAAAGATACAAATTCTTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-637s1c1
Sequence:CCGGGTGCTGTTGTTCATTACACAACTCGAGTTGTGTAATGAACAACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-859s1c1
Sequence:CCGGCCTTGGACTCAAGAGACATTACTCGAGTAATGTCTCTTGAGTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-1131s1c1
Sequence:CCGGGCCAAGTTGATGGGTTTCTTTCTCGAGAAAGAAACCCATCAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-1371s1c1
Sequence:CCGGGAAGCAAAGAAGATTGCGAAACTCGAGTTTCGCAATCTTCTTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110668
KDELC2 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_110668.2-2319s1c1
Sequence:CCGGCCGGCAAGAATTTGTATCTTTCTCGAGAAAGATACAAATTCTTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-637s1c1
Sequence:CCGGGTGCTGTTGTTCATTACACAACTCGAGTTGTGTAATGAACAACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-859s1c1
Sequence:CCGGCCTTGGACTCAAGAGACATTACTCGAGTAATGTCTCTTGAGTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-1131s1c1
Sequence:CCGGGCCAAGTTGATGGGTTTCTTTCTCGAGAAAGAAACCCATCAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-1371s1c1
Sequence:CCGGGAAGCAAAGAAGATTGCGAAACTCGAGTTTCGCAATCTTCTTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110668
KDELC2 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_110668.2-2319s1c1
Sequence:CCGGCCGGCAAGAATTTGTATCTTTCTCGAGAAAGATACAAATTCTTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-637s1c1
Sequence:CCGGGTGCTGTTGTTCATTACACAACTCGAGTTGTGTAATGAACAACAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-859s1c1
Sequence:CCGGCCTTGGACTCAAGAGACATTACTCGAGTAATGTCTCTTGAGTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-1131s1c1
Sequence:CCGGGCCAAGTTGATGGGTTTCTTTCTCGAGAAAGAAACCCATCAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110668.2-1371s1c1
Sequence:CCGGGAAGCAAAGAAGATTGCGAAACTCGAGTTTCGCAATCTTCTTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153705
VALIDATED
KDELC2 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-2508s1c1
Sequence:CCGGCGAGACAACATTAAGGAGAAACTCGAGTTTCTCCTTAATGTTGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153705.2-1460s1c1
Sequence:CCGGCGTGATGGAATGGAACTTGTTCTCGAGAACAAGTTCCATTCCATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-637s1c1
Sequence:CCGGCCGGAGATCTTTAGGGAAATACTCGAGTATTTCCCTAAAGATCTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-1091s1c1
Sequence:CCGGGCCAAGTTGATGGGTTTCTTTCTCGAGAAAGAAACCCATCAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-1226s1c1
Sequence:CCGGGAACATTTCTACATGGCACTACTCGAGTAGTGCCATGTAGAAATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-599s1c1
Sequence:CCGGGCCATTGTTCATTACACGATTCTCGAGAATCGTGTAATGAACAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153705.2-374s1c1
Sequence:CCGGGAGGTCCTTTATGGTGATGAACTCGAGTTCATCACCATAAAGGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153705
VALIDATED
KDELC2 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-2508s1c1
Sequence:CCGGCGAGACAACATTAAGGAGAAACTCGAGTTTCTCCTTAATGTTGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153705.2-1460s1c1
Sequence:CCGGCGTGATGGAATGGAACTTGTTCTCGAGAACAAGTTCCATTCCATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-637s1c1
Sequence:CCGGCCGGAGATCTTTAGGGAAATACTCGAGTATTTCCCTAAAGATCTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-1091s1c1
Sequence:CCGGGCCAAGTTGATGGGTTTCTTTCTCGAGAAAGAAACCCATCAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-1226s1c1
Sequence:CCGGGAACATTTCTACATGGCACTACTCGAGTAGTGCCATGTAGAAATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-599s1c1
Sequence:CCGGGCCATTGTTCATTACACGATTCTCGAGAATCGTGTAATGAACAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153705.2-374s1c1
Sequence:CCGGGAGGTCCTTTATGGTGATGAACTCGAGTTCATCACCATAAAGGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153705
VALIDATED
KDELC2 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-2508s1c1
Sequence:CCGGCGAGACAACATTAAGGAGAAACTCGAGTTTCTCCTTAATGTTGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153705.2-1460s1c1
Sequence:CCGGCGTGATGGAATGGAACTTGTTCTCGAGAACAAGTTCCATTCCATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-637s1c1
Sequence:CCGGCCGGAGATCTTTAGGGAAATACTCGAGTATTTCCCTAAAGATCTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-1091s1c1
Sequence:CCGGGCCAAGTTGATGGGTTTCTTTCTCGAGAAAGAAACCCATCAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-1226s1c1
Sequence:CCGGGAACATTTCTACATGGCACTACTCGAGTAGTGCCATGTAGAAATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153705.2-599s1c1
Sequence:CCGGGCCATTGTTCATTACACGATTCTCGAGAATCGTGTAATGAACAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153705.2-374s1c1
Sequence:CCGGGAGGTCCTTTATGGTGATGAACTCGAGTTCATCACCATAAAGGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)