EMAIL THIS PAGE TO A FRIEND

KDM1A

lysine (K)-specific demethylase 1A

71 Gene Product Result for
Synonyms: AOF2 BHC110 KDM1 LSD1
Gene ID:
Human(23028) Summary: This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(99982) lysine (K)-specific demethylase 1A
Rat(500569) lysine (K)-specific demethylase 1A
sheep(101121409) lysine (K)-specific demethylase 1A
domestic guinea pig(100723459) lysine (K)-specific demethylase 1A
naked mole-rat(101706376) lysine (K)-specific demethylase 1A
Zebrafish(558450) lysine (K)-specific demethylase 1a
chicken(419571) lysine (K)-specific demethylase 1A
dog(478193) lysine (K)-specific demethylase 1A
domestic cat(101096583) lysine (K)-specific demethylase 1A
Horse(100071646) lysine (K)-specific demethylase 1A
cow(532997) lysine (K)-specific demethylase 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407168 Anti-AOF2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA053660 Anti-KDM1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
L4418 Anti-LSD1 (AOF2) (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat (predicted), mouse (predicted), human
immunocytochemistry, immunoprecipitation (IP), western blot pricing
L4793 Anti-LSD1 (AOF2) (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat (predicted), human, mouse (predicted)
immunoprecipitation (IP), microarray, western blot pricing
SAB1306220 ANTI-LSD1 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB3500229 Anti-LSD1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB3500953 Anti-LSD1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306581 ANTI-LSD1(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306580 ANTI-LSD1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0023028M4 Monoclonal Anti-AOF2 antibody produced in mouse clone 2E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
L7293 Monoclonal Anti-LSD1 (AOF2) antibody produced in mouse ~2 mg/mL, clone LSD1-12, purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015013 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015013 Rosetta Predictions human pricing
NM_001130098 Rosetta Predictions rat pricing
NM_133872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213078 predicted 847
2 SASI_Hs01_00213079 predicted 919
3 SASI_Hs01_00213080 predicted 871
4 SASI_Hs01_00213081 predicted 1306
5 SASI_Hs02_00346784 predicted 1422
6 SASI_Hs01_00213082 predicted 2230
7 SASI_Hs01_00213083 predicted 1553
8 SASI_Hs01_00213084 predicted 1841
9 SASI_Hs01_00213085 predicted 1619
10 SASI_Hs01_00213086 predicted 856
11 SASI_Hs01_00213077 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255329 predicted 978
2 SASI_Rn02_00255330 predicted 993
3 SASI_Rn02_00255331 predicted 828
4 SASI_Rn02_00255332 predicted 1367
5 SASI_Rn02_00255333 predicted 1388
6 SASI_Rn02_00255334 predicted 1169
7 SASI_Rn02_00255335 predicted 2281
8 SASI_Rn02_00255336 predicted 918
9 SASI_Rn02_00255337 predicted 2595
10 SASI_Rn02_00255338 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192798 predicted 1284
2 SASI_Mm01_00192799 predicted 758
3 SASI_Mm02_00338932 predicted 2403
4 SASI_Mm01_00192800 predicted 914
5 SASI_Mm01_00192802 predicted 1990
6 SASI_Mm01_00192803 predicted 885
7 SASI_Mm02_00338933 predicted 1411
8 SASI_Mm01_00192804 predicted 900
9 SASI_Mm01_00192805 predicted 1397
10 SASI_Mm01_00192807 predicted 1318
11 SASI_Mm01_00192801 predicted 1792
12 SASI_Mm01_00192806 predicted 1506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015013
VALIDATED
KDM1A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 1A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-775s1c1
Sequence:CCGGCCAACAATTAGAAGCACCTTACTCGAGTAAGGTGCTTCTAATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1896s1c1
Sequence:CCGGCCACGAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1812s1c1
Sequence:CCGGGCCTAGACATTAAACTGAATACTCGAGTATTCAGTTTAATGTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1232s1c1
Sequence:CCGGGCTACATCTTACCTTAGTCATCTCGAGATGACTAAGGTAAGATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-1975s21c1
Sequence:CCGGCCACGAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015013.3-2247s21c1
Sequence:CCGGGCTCCAATACTGTTGGCACTACTCGAGTAGTGCCAACAGTATTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-2168s1c1
Sequence:CCGGGCTCCAATACTGTTGGCACTACTCGAGTAGTGCCAACAGTATTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-2833s21c1
Sequence:GTACCGGGGAGCTCCTGATTTGACAAAGCTCGAGCTTTGTCAAATCAGGAGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-2759s21c1
Sequence:GTACCGGAGGAAGGCTCTTCTAGCAATACTCGAGTATTGCTAGAAGAGCCTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015013.3-2859s21c1
Sequence:GTACCGGTGCCTCCTTTGAATGACCTAGCTCGAGCTAGGTCATTCAAAGGAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-1891s21c1
Sequence:CCGGGCCTAGACATTAAACTGAATACTCGAGTATTCAGTTTAATGTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015013.3-1311s21c1
Sequence:CCGGGCTACATCTTACCTTAGTCATCTCGAGATGACTAAGGTAAGATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015013
VALIDATED
KDM1A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 1A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-775s1c1
Sequence:CCGGCCAACAATTAGAAGCACCTTACTCGAGTAAGGTGCTTCTAATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1896s1c1
Sequence:CCGGCCACGAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1812s1c1
Sequence:CCGGGCCTAGACATTAAACTGAATACTCGAGTATTCAGTTTAATGTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1232s1c1
Sequence:CCGGGCTACATCTTACCTTAGTCATCTCGAGATGACTAAGGTAAGATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-1975s21c1
Sequence:CCGGCCACGAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015013.3-2247s21c1
Sequence:CCGGGCTCCAATACTGTTGGCACTACTCGAGTAGTGCCAACAGTATTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-2168s1c1
Sequence:CCGGGCTCCAATACTGTTGGCACTACTCGAGTAGTGCCAACAGTATTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-2833s21c1
Sequence:GTACCGGGGAGCTCCTGATTTGACAAAGCTCGAGCTTTGTCAAATCAGGAGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-2759s21c1
Sequence:GTACCGGAGGAAGGCTCTTCTAGCAATACTCGAGTATTGCTAGAAGAGCCTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015013.3-2859s21c1
Sequence:GTACCGGTGCCTCCTTTGAATGACCTAGCTCGAGCTAGGTCATTCAAAGGAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-1891s21c1
Sequence:CCGGGCCTAGACATTAAACTGAATACTCGAGTATTCAGTTTAATGTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015013.3-1311s21c1
Sequence:CCGGGCTACATCTTACCTTAGTCATCTCGAGATGACTAAGGTAAGATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015013
VALIDATED
KDM1A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 1A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-775s1c1
Sequence:CCGGCCAACAATTAGAAGCACCTTACTCGAGTAAGGTGCTTCTAATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1896s1c1
Sequence:CCGGCCACGAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1812s1c1
Sequence:CCGGGCCTAGACATTAAACTGAATACTCGAGTATTCAGTTTAATGTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-1232s1c1
Sequence:CCGGGCTACATCTTACCTTAGTCATCTCGAGATGACTAAGGTAAGATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-1975s21c1
Sequence:CCGGCCACGAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015013.3-2247s21c1
Sequence:CCGGGCTCCAATACTGTTGGCACTACTCGAGTAGTGCCAACAGTATTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015013.1-2168s1c1
Sequence:CCGGGCTCCAATACTGTTGGCACTACTCGAGTAGTGCCAACAGTATTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382379    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-2833s21c1
Sequence:GTACCGGGGAGCTCCTGATTTGACAAAGCTCGAGCTTTGTCAAATCAGGAGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-2759s21c1
Sequence:GTACCGGAGGAAGGCTCTTCTAGCAATACTCGAGTATTGCTAGAAGAGCCTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015013.3-2859s21c1
Sequence:GTACCGGTGCCTCCTTTGAATGACCTAGCTCGAGCTAGGTCATTCAAAGGAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015013.3-1891s21c1
Sequence:CCGGGCCTAGACATTAAACTGAATACTCGAGTATTCAGTTTAATGTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015013.3-1311s21c1
Sequence:CCGGGCTACATCTTACCTTAGTCATCTCGAGATGACTAAGGTAAGATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133872
VALIDATED
KDM1A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 1A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-920s1c1
Sequence:CCGGCGGCATCTACAAGAGGATAAACTCGAGTTTATCCTCTTGTAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-1863s1c1
Sequence:CCGGGCTGAAGGCTTGGACATTAAACTCGAGTTTAATGTCCAAGCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-475s1c1
Sequence:CCGGCCAAGGTAGAATACAGAGAAACTCGAGTTTCTCTGTATTCTACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-1954s1c1
Sequence:CCGGCCACAAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-1967s21c1
Sequence:CCGGCCACAAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-488s21c1
Sequence:CCGGCCAAGGTAGAATACAGAGAAACTCGAGTTTCTCTGTATTCTACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-1459s21c1
Sequence:CCGGGAGTTGAAAGAGCTTCTTAATCTCGAGATTAAGAAGCTCTTTCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-933s21c1
Sequence:CCGGCGGCATCTACAAGAGGATAAACTCGAGTTTATCCTCTTGTAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133872
VALIDATED
KDM1A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 1A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-920s1c1
Sequence:CCGGCGGCATCTACAAGAGGATAAACTCGAGTTTATCCTCTTGTAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-1863s1c1
Sequence:CCGGGCTGAAGGCTTGGACATTAAACTCGAGTTTAATGTCCAAGCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-475s1c1
Sequence:CCGGCCAAGGTAGAATACAGAGAAACTCGAGTTTCTCTGTATTCTACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-1954s1c1
Sequence:CCGGCCACAAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-1967s21c1
Sequence:CCGGCCACAAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-488s21c1
Sequence:CCGGCCAAGGTAGAATACAGAGAAACTCGAGTTTCTCTGTATTCTACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-1459s21c1
Sequence:CCGGGAGTTGAAAGAGCTTCTTAATCTCGAGATTAAGAAGCTCTTTCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-933s21c1
Sequence:CCGGCGGCATCTACAAGAGGATAAACTCGAGTTTATCCTCTTGTAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133872
VALIDATED
KDM1A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 1A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-920s1c1
Sequence:CCGGCGGCATCTACAAGAGGATAAACTCGAGTTTATCCTCTTGTAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-1863s1c1
Sequence:CCGGGCTGAAGGCTTGGACATTAAACTCGAGTTTAATGTCCAAGCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-475s1c1
Sequence:CCGGCCAAGGTAGAATACAGAGAAACTCGAGTTTCTCTGTATTCTACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133872.1-1954s1c1
Sequence:CCGGCCACAAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-1967s21c1
Sequence:CCGGCCACAAGTCAAACCTTTATTTCTCGAGAAATAAAGGTTTGACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-488s21c1
Sequence:CCGGCCAAGGTAGAATACAGAGAAACTCGAGTTTCTCTGTATTCTACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-1459s21c1
Sequence:CCGGGAGTTGAAAGAGCTTCTTAATCTCGAGATTAAGAAGCTCTTTCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133872.2-933s21c1
Sequence:CCGGCGGCATCTACAAGAGGATAAACTCGAGTTTATCCTCTTGTAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)