EMAIL THIS PAGE TO A FRIEND

KDM1B

lysine (K)-specific demethylase 1B

121 Gene Product Result for
Synonyms: AOF1 C6orf193 LSD2 bA204B7.3 dJ298J15.2
Gene ID:
Human(221656) Summary: Flavin-dependent histone demethylases, such as KDM1B, regulate histone lysine methylation, an epigenetic mark that regulates gene expression and chromatin function (Karytinos et al., 2009 [PubMed 19407342]
Mouse(218214) lysine (K)-specific demethylase 1B
Rat(306819) lysine (K)-specific demethylase 1B
chicken(420829) lysine (K)-specific demethylase 1B
cow(513667) lysine (K)-specific demethylase 1B
Horse(100066240) lysine (K)-specific demethylase 1B
domestic cat(101099460) lysine (K)-specific demethylase 1B
dog(478733) lysine (K)-specific demethylase 1B
domestic guinea pig(100722433) lysine (K)-specific demethylase 1B
naked mole-rat(101711296) lysine (K)-specific demethylase 1B
sheep(101122986) lysine (K)-specific demethylase 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153042 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_173173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_173173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_173173 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052581 MISSION® esiRNA esiRNA human AOF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153042 Rosetta Predictions human pricing
NM_001107343 Rosetta Predictions rat pricing
NM_172262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032209 predicted 1146
2 SASI_Hs01_00032210 predicted 1038
3 SASI_Hs01_00032211 predicted 508
4 SASI_Hs01_00032212 predicted 539
5 SASI_Hs02_00366997 predicted 812
6 SASI_Hs01_00032213 predicted 518
7 SASI_Hs01_00032215 predicted 732
8 SASI_Hs01_00032216 predicted 1332
9 SASI_Hs01_00032217 predicted 1935
10 SASI_Hs01_00032218 predicted 1243
11 SASI_Hs01_00032214 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227895 predicted 1426
2 SASI_Rn02_00227896 predicted 2597
3 SASI_Rn02_00227897 predicted 2512
4 SASI_Rn02_00227898 predicted 2449
5 SASI_Rn02_00227899 predicted 2397
6 SASI_Rn02_00227900 predicted 2528
7 SASI_Rn02_00227901 predicted 2627
8 SASI_Rn02_00227902 predicted 2505
9 SASI_Rn02_00227903 predicted 1614
10 SASI_Rn02_00227904 predicted 1634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080229 predicted 1448
2 SASI_Mm01_00080230 predicted 2613
3 SASI_Mm01_00080231 predicted 628
4 SASI_Mm01_00080232 predicted 1280
5 SASI_Mm02_00343729 predicted 1262
6 SASI_Mm01_00080234 predicted 2530
7 SASI_Mm01_00080235 predicted 2641
8 SASI_Mm01_00080236 predicted 1637
9 SASI_Mm01_00080237 predicted 1530
10 SASI_Mm01_00080238 predicted 1839
11 SASI_Mm01_00080233 predicted 1920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153042
VALIDATED
KDM1B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-3120s21c1
Sequence:CCGGGGGTCTTCAGGATGCCTATTTCTCGAGAAATAGGCATCCTGAAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-1273s21c1
Sequence:CCGGTCCCGGGTACTCGGTGATAATCTCGAGATTATCACCGAGTACCCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153042.3-753s21c1
Sequence:CCGGTGAAACCAAATACTGCTATTACTCGAGTAATAGCAGTATTTGGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-1173s21c1
Sequence:CCGGTTAACAACCCAGTAGCATTAACTCGAGTTAATGCTACTGGGTTGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153042.3-1101s21c1
Sequence:CCGGGCCGAGTCTGGGATGATAAATCTCGAGATTTATCATCCCAGACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153042
VALIDATED
KDM1B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-3120s21c1
Sequence:CCGGGGGTCTTCAGGATGCCTATTTCTCGAGAAATAGGCATCCTGAAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-1273s21c1
Sequence:CCGGTCCCGGGTACTCGGTGATAATCTCGAGATTATCACCGAGTACCCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153042.3-753s21c1
Sequence:CCGGTGAAACCAAATACTGCTATTACTCGAGTAATAGCAGTATTTGGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-1173s21c1
Sequence:CCGGTTAACAACCCAGTAGCATTAACTCGAGTTAATGCTACTGGGTTGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153042.3-1101s21c1
Sequence:CCGGGCCGAGTCTGGGATGATAAATCTCGAGATTTATCATCCCAGACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153042
VALIDATED
KDM1B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-3120s21c1
Sequence:CCGGGGGTCTTCAGGATGCCTATTTCTCGAGAAATAGGCATCCTGAAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-1273s21c1
Sequence:CCGGTCCCGGGTACTCGGTGATAATCTCGAGATTATCACCGAGTACCCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153042.3-753s21c1
Sequence:CCGGTGAAACCAAATACTGCTATTACTCGAGTAATAGCAGTATTTGGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153042.3-1173s21c1
Sequence:CCGGTTAACAACCCAGTAGCATTAACTCGAGTTAATGCTACTGGGTTGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153042.3-1101s21c1
Sequence:CCGGGCCGAGTCTGGGATGATAAATCTCGAGATTTATCATCCCAGACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172262
VALIDATED
KDM1B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-3567s1c1
Sequence:CCGGGCCAAGAAACTTCAGTTGATACTCGAGTATCAACTGAAGTTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-1065s1c1
Sequence:CCGGCCTGGCTTTGAGAAACCTCATCTCGAGATGAGGTTTCTCAAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-2470s1c1
Sequence:CCGGGCCTATGATATTATTGCTGAACTCGAGTTCAGCAATAATATCATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-417s1c1
Sequence:CCGGCCACTACTACAGAAGCCACAACTCGAGTTGTGGCTTCTGTAGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-2584s1c1
Sequence:CCGGGCAAGCAAGATTGCAGCCTTTCTCGAGAAAGGCTGCAATCTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172262
VALIDATED
KDM1B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-3567s1c1
Sequence:CCGGGCCAAGAAACTTCAGTTGATACTCGAGTATCAACTGAAGTTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-1065s1c1
Sequence:CCGGCCTGGCTTTGAGAAACCTCATCTCGAGATGAGGTTTCTCAAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-2470s1c1
Sequence:CCGGGCCTATGATATTATTGCTGAACTCGAGTTCAGCAATAATATCATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-417s1c1
Sequence:CCGGCCACTACTACAGAAGCCACAACTCGAGTTGTGGCTTCTGTAGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-2584s1c1
Sequence:CCGGGCAAGCAAGATTGCAGCCTTTCTCGAGAAAGGCTGCAATCTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172262
VALIDATED
KDM1B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076613    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-3567s1c1
Sequence:CCGGGCCAAGAAACTTCAGTTGATACTCGAGTATCAACTGAAGTTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-1065s1c1
Sequence:CCGGCCTGGCTTTGAGAAACCTCATCTCGAGATGAGGTTTCTCAAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-2470s1c1
Sequence:CCGGGCCTATGATATTATTGCTGAACTCGAGTTCAGCAATAATATCATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-417s1c1
Sequence:CCGGCCACTACTACAGAAGCCACAACTCGAGTTGTGGCTTCTGTAGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172262.1-2584s1c1
Sequence:CCGGGCAAGCAAGATTGCAGCCTTTCTCGAGAAAGGCTGCAATCTTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_173173
VALIDATED
KDM1B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_173173.3-1927s1c1
Sequence:CCGGGCAAGCAAGATTGCAGCATTTCTCGAGAAATGCTGCAATCTTGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_173173.3-1363s1c1
Sequence:CCGGCCACTGGCTTTACTACAGAAACTCGAGTTTCTGTAGTAAAGCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_173173.3-1564s1c1
Sequence:CCGGGCCGTGTTCTATGACATGGATCTCGAGATCCATGTCATAGAACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:XM_173173.3-468s1c1
Sequence:CCGGCCATTACTACAGAAGCCATAACTCGAGTTATGGCTTCTGTAGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_173173.3-921s1c1
Sequence:CCGGCCACAATAAATCAGTCATCATCTCGAGATGATGACTGATTTATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_173173
VALIDATED
KDM1B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_173173.3-1927s1c1
Sequence:CCGGGCAAGCAAGATTGCAGCATTTCTCGAGAAATGCTGCAATCTTGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_173173.3-1363s1c1
Sequence:CCGGCCACTGGCTTTACTACAGAAACTCGAGTTTCTGTAGTAAAGCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_173173.3-1564s1c1
Sequence:CCGGGCCGTGTTCTATGACATGGATCTCGAGATCCATGTCATAGAACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:XM_173173.3-468s1c1
Sequence:CCGGCCATTACTACAGAAGCCATAACTCGAGTTATGGCTTCTGTAGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_173173.3-921s1c1
Sequence:CCGGCCACAATAAATCAGTCATCATCTCGAGATGATGACTGATTTATTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_173173
VALIDATED
KDM1B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_173173.3-1927s1c1
Sequence:CCGGGCAAGCAAGATTGCAGCATTTCTCGAGAAATGCTGCAATCTTGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_173173.3-1363s1c1
Sequence:CCGGCCACTGGCTTTACTACAGAAACTCGAGTTTCTGTAGTAAAGCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_173173.3-1564s1c1
Sequence:CCGGGCCGTGTTCTATGACATGGATCTCGAGATCCATGTCATAGAACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:XM_173173.3-468s1c1
Sequence:CCGGCCATTACTACAGAAGCCATAACTCGAGTTATGGCTTCTGTAGTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_173173.3-921s1c1
Sequence:CCGGCCACAATAAATCAGTCATCATCTCGAGATGATGACTGATTTATTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)