EMAIL THIS PAGE TO A FRIEND

KDM2A

lysine (K)-specific demethylase 2A

333 Gene Product Result for
Synonyms: CXXC8 FBL11 FBL7 FBXL11 JHDM1A LILINA
Gene ID:
Human(22992) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(225876) lysine (K)-specific demethylase 2A
Rat(361700) lysine (K)-specific demethylase 2A
Zebrafish(799441) lysine (K)-specific demethylase 2A
cow(540141) lysine (K)-specific demethylase 2A
Horse(100052955) lysine (K)-specific demethylase 2A
domestic cat(101090549) lysine (K)-specific demethylase 2A
dog(483702) lysine (K)-specific demethylase 2A
chicken(425999) lysine (K)-specific demethylase 2A
sheep(101108003) lysine (K)-specific demethylase 2A
domestic guinea pig(100732285) lysine (K)-specific demethylase 2A
naked mole-rat(101713712) lysine (K)-specific demethylase 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012308 Rosetta Predictions human pricing
NM_001108515 Rosetta Predictions rat pricing
NM_001001984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011898 predicted 940
2 SASI_Hs01_00011899 predicted 314
3 SASI_Hs02_00344081 predicted 237
4 SASI_Hs01_00011900 predicted 1145
5 SASI_Hs01_00011901 predicted 1191
6 SASI_Hs01_00011902 predicted 3398
7 SASI_Hs01_00011904 predicted 1615
8 SASI_Hs01_00011905 predicted 1725
9 SASI_Hs01_00011906 predicted 3572
10 SASI_Hs01_00011907 predicted 1709
11 SASI_Hs01_00011903 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239409 predicted 1323
2 SASI_Rn02_00239410 predicted 1210
3 SASI_Rn02_00239411 predicted 1574
4 SASI_Rn02_00239412 predicted 3458
5 SASI_Rn02_00239413 predicted 1139
6 SASI_Rn02_00239414 predicted 3851
7 SASI_Rn02_00239415 predicted 1369
8 SASI_Rn02_00239416 predicted 1879
9 SASI_Rn02_00239417 predicted 2421
10 SASI_Rn02_00239418 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024076 predicted 1646
2 SASI_Mm01_00024077 predicted 2270
3 SASI_Mm01_00024078 predicted 3895
4 SASI_Mm02_00286254 predicted 1382
5 SASI_Mm01_00024079 predicted 3653
6 SASI_Mm02_00286255 predicted 2207
7 SASI_Mm01_00024080 predicted 4109
8 SASI_Mm01_00024081 predicted 4283
9 SASI_Mm01_00024082 predicted 1808
10 SASI_Mm02_00286256 predicted 4293
11 SASI_Mm01_00024083 predicted 1747
12 SASI_Mm01_00024084 predicted 1037
13 SASI_Mm01_00024085 predicted 1375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012308
VALIDATED
KDM2A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 2A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012308.1-318s1c1
Sequence:CCGGGCTTGAGAGATCCTCTGATTTCTCGAGAAATCAGAGGATCTCTCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-4022s21c1
Sequence:CCGGATGCCACGCTTCGCCTCATAACTCGAGTTATGAGGCGAAGCGTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-1006s1c1
Sequence:CCGGGCATAGCTTCAACATCCCTATCTCGAGATAGGGATGTTGAAGCTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-3574s1c1
Sequence:CCGGGCTGATACAGAAGATCAGCTACTCGAGTAGCTGATCTTCTGTATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012308.1-2823s1c1
Sequence:CCGGGCCGCAGAGAACTTTGTGAATCTCGAGATTCACAAAGTTCTCTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-1541s1c1
Sequence:CCGGCCCACAGGGATAGAAGATGAACTCGAGTTCATCTTCTATCCCTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-3768s21c1
Sequence:CCGGACTGACATGGCTCGTCAATAGCTCGAGCTATTGACGAGCCATGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-1835s21c1
Sequence:CCGGTTCGCTATCCATTCTACTATGCTCGAGCATAGTAGAATGGATAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-3930s21c1
Sequence:CCGGGCTTACTCCACCGGCTGATAACTCGAGTTATCAGCCGGTGGAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-1270s21c1
Sequence:CCGGGAGCGAGAGAAACTCTATAATCTCGAGATTATAGAGTTTCTCTCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-1104s21c1
Sequence:CCGGTTCTGATGGACTCGGAATAAACTCGAGTTTATTCCGAGTCCATCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012308
VALIDATED
KDM2A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 2A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012308.1-318s1c1
Sequence:CCGGGCTTGAGAGATCCTCTGATTTCTCGAGAAATCAGAGGATCTCTCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-4022s21c1
Sequence:CCGGATGCCACGCTTCGCCTCATAACTCGAGTTATGAGGCGAAGCGTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-1006s1c1
Sequence:CCGGGCATAGCTTCAACATCCCTATCTCGAGATAGGGATGTTGAAGCTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-3574s1c1
Sequence:CCGGGCTGATACAGAAGATCAGCTACTCGAGTAGCTGATCTTCTGTATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012308.1-2823s1c1
Sequence:CCGGGCCGCAGAGAACTTTGTGAATCTCGAGATTCACAAAGTTCTCTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-1541s1c1
Sequence:CCGGCCCACAGGGATAGAAGATGAACTCGAGTTCATCTTCTATCCCTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-3768s21c1
Sequence:CCGGACTGACATGGCTCGTCAATAGCTCGAGCTATTGACGAGCCATGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-1835s21c1
Sequence:CCGGTTCGCTATCCATTCTACTATGCTCGAGCATAGTAGAATGGATAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-3930s21c1
Sequence:CCGGGCTTACTCCACCGGCTGATAACTCGAGTTATCAGCCGGTGGAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-1270s21c1
Sequence:CCGGGAGCGAGAGAAACTCTATAATCTCGAGATTATAGAGTTTCTCTCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-1104s21c1
Sequence:CCGGTTCTGATGGACTCGGAATAAACTCGAGTTTATTCCGAGTCCATCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012308
VALIDATED
KDM2A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 2A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012308.1-318s1c1
Sequence:CCGGGCTTGAGAGATCCTCTGATTTCTCGAGAAATCAGAGGATCTCTCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-4022s21c1
Sequence:CCGGATGCCACGCTTCGCCTCATAACTCGAGTTATGAGGCGAAGCGTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-1006s1c1
Sequence:CCGGGCATAGCTTCAACATCCCTATCTCGAGATAGGGATGTTGAAGCTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-3574s1c1
Sequence:CCGGGCTGATACAGAAGATCAGCTACTCGAGTAGCTGATCTTCTGTATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012308.1-2823s1c1
Sequence:CCGGGCCGCAGAGAACTTTGTGAATCTCGAGATTCACAAAGTTCTCTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012308.1-1541s1c1
Sequence:CCGGCCCACAGGGATAGAAGATGAACTCGAGTTCATCTTCTATCCCTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-3768s21c1
Sequence:CCGGACTGACATGGCTCGTCAATAGCTCGAGCTATTGACGAGCCATGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-1835s21c1
Sequence:CCGGTTCGCTATCCATTCTACTATGCTCGAGCATAGTAGAATGGATAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-3930s21c1
Sequence:CCGGGCTTACTCCACCGGCTGATAACTCGAGTTATCAGCCGGTGGAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012308.2-1270s21c1
Sequence:CCGGGAGCGAGAGAAACTCTATAATCTCGAGATTATAGAGTTTCTCTCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012308.2-1104s21c1
Sequence:CCGGTTCTGATGGACTCGGAATAAACTCGAGTTTATTCCGAGTCCATCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001984
VALIDATED
KDM2A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-3105s1c1
Sequence:CCGGGCCGCAAAGAACTTTGTGAATCTCGAGATTCACAAAGTTCTTTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-521s1c1
Sequence:CCGGGCTCCAAACCAACAAATATAACTCGAGTTATATTTGTTGGTTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-1776s1c1
Sequence:CCGGCGATGTCTTGTAGATAAGTTACTCGAGTAACTTATCTACAAGACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001984.1-1827s1c1
Sequence:CCGGCCCACAGGAATAGAAGACGAACTCGAGTTCGTCTTCTATTCCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001984.1-2233s1c1
Sequence:CCGGTGCCTCATTCAGTTACGTGTTCTCGAGAACACGTAACTGAATGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001984
VALIDATED
KDM2A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-3105s1c1
Sequence:CCGGGCCGCAAAGAACTTTGTGAATCTCGAGATTCACAAAGTTCTTTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-521s1c1
Sequence:CCGGGCTCCAAACCAACAAATATAACTCGAGTTATATTTGTTGGTTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-1776s1c1
Sequence:CCGGCGATGTCTTGTAGATAAGTTACTCGAGTAACTTATCTACAAGACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001984.1-1827s1c1
Sequence:CCGGCCCACAGGAATAGAAGACGAACTCGAGTTCGTCTTCTATTCCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001984.1-2233s1c1
Sequence:CCGGTGCCTCATTCAGTTACGTGTTCTCGAGAACACGTAACTGAATGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001984
VALIDATED
KDM2A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-3105s1c1
Sequence:CCGGGCCGCAAAGAACTTTGTGAATCTCGAGATTCACAAAGTTCTTTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-521s1c1
Sequence:CCGGGCTCCAAACCAACAAATATAACTCGAGTTATATTTGTTGGTTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001984.1-1776s1c1
Sequence:CCGGCGATGTCTTGTAGATAAGTTACTCGAGTAACTTATCTACAAGACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001984.1-1827s1c1
Sequence:CCGGCCCACAGGAATAGAAGACGAACTCGAGTTCGTCTTCTATTCCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001984.1-2233s1c1
Sequence:CCGGTGCCTCATTCAGTTACGTGTTCTCGAGAACACGTAACTGAATGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)