EMAIL THIS PAGE TO A FRIEND

KDM2B

lysine (K)-specific demethylase 2B

207 Gene Product Result for
Synonyms: CXXC2 FBXL10 Fbl10 JHDM1B PCCX2
Gene ID:
Human(84678) Summary: This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(30841) lysine (K)-specific demethylase 2B
Rat(304495) lysine (K)-specific demethylase 2B
chicken(416844) lysine (K)-specific demethylase 2B
domestic cat(101094455) lysine (K)-specific demethylase 2B
cow(614487) lysine (K)-specific demethylase 2B
Horse(100059690) lysine (K)-specific demethylase 2B
dog(486262) lysine (K)-specific demethylase 2B
domestic guinea pig(100726076) lysine (K)-specific demethylase 2B
naked mole-rat(101696346) lysine (K)-specific demethylase 2B
sheep(101103759) lysine (K)-specific demethylase 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108755 Anti-FBXL10 affinity isolated antibody horse, canine, rabbit, bovine, rat, mouse, zebrafish, guinea pig, human
western blot pricing
SAB2501147 Anti-FBXL10 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2104490 Anti-FBXL10 antibody produced in rabbit affinity isolated antibody canine, rat, guinea pig, rabbit, bovine, human, zebrafish, mouse, horse
western blot pricing
SAB1305676 ANTI-FBXL10B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB2702002 Anti-KDM2B (C-terminal) antibody produced in rabbit human, mouse, rat
immunohistochemistry, western blot pricing
WH0084678M9 Monoclonal Anti-FBXL10 antibody produced in mouse clone 5G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032590 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_144523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_144523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_144523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005366 Rosetta Predictions human pricing
NM_032590 Rosetta Predictions human pricing
XM_001075313 Rosetta Predictions rat pricing
XM_001075343 Rosetta Predictions rat pricing
XM_222177 Rosetta Predictions rat pricing
NM_001003953 Rosetta Predictions mouse pricing
NM_001005866 Rosetta Predictions mouse pricing
NM_013910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058561 predicted 1002
2 SASI_Hs01_00058562 predicted 1285
3 SASI_Hs01_00058564 predicted 1326
4 SASI_Hs01_00058565 predicted 1976
5 SASI_Hs01_00058566 predicted 2341
6 SASI_Hs01_00058568 predicted 760
7 SASI_Hs02_00304871 predicted 1858
8 SASI_Hs01_00058569 predicted 1816
9 SASI_Hs02_00304872 predicted 1274
10 SASI_Hs01_00058570 predicted 2511
11 SASI_Hs01_00058563 predicted 3795
12 SASI_Hs01_00058567 predicted 2238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170025 predicted 754
2 SASI_Hs01_00170026 predicted 1045
3 SASI_Hs01_00170028 predicted 1089
4 SASI_Hs01_00170029 predicted 1731
5 SASI_Hs01_00170030 predicted 2101
6 SASI_Hs01_00170032 predicted 512
7 SASI_Hs02_00360121 predicted 1613
8 SASI_Hs01_00170033 predicted 1579
9 SASI_Hs02_00360122 predicted 1030
10 SASI_Hs01_00170034 predicted 2275
11 SASI_Hs01_00170027 predicted 3674
12 SASI_Hs01_00170031 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349290 predicted 2324
2 SASI_Rn02_00349291 predicted 559
3 SASI_Rn02_00349292 predicted 1279
4 SASI_Rn02_00349293 predicted 2049
5 SASI_Rn02_00349294 predicted 1400
6 SASI_Rn02_00349295 predicted 2527
7 SASI_Rn02_00349296 predicted 2271
8 SASI_Rn02_00349297 predicted 2190
9 SASI_Rn02_00349298 predicted 1159
10 SASI_Rn02_00349299 predicted 2129
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349406 predicted 3777
2 SASI_Rn02_00349407 predicted 3784
3 SASI_Rn02_00349408 predicted 1449
4 SASI_Rn02_00349409 predicted 2737
5 SASI_Rn02_00349410 predicted 2850
6 SASI_Rn02_00349411 predicted 1545
7 SASI_Rn02_00349412 predicted 3711
8 SASI_Rn02_00349413 predicted 3648
9 SASI_Rn02_00349414 predicted 921
10 SASI_Rn02_00349415 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380605 predicted 4004
2 SASI_Rn02_00380606 predicted 4016
3 SASI_Rn02_00380607 predicted 1672
4 SASI_Rn02_00380608 predicted 3077
5 SASI_Rn02_00380609 predicted 1768
6 SASI_Rn02_00380610 predicted 3943
7 SASI_Rn02_00380611 predicted 3874
8 SASI_Rn02_00380612 predicted 1145
9 SASI_Rn02_00380613 predicted 1027
10 SASI_Rn02_00380614 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028562 predicted 3977
2 SASI_Mm01_00028563 predicted 3990
3 SASI_Mm01_00028564 predicted 3924
4 SASI_Mm01_00028565 predicted 3705
5 SASI_Mm01_00028566 predicted 2137
6 SASI_Mm01_00028567 predicted 3834
7 SASI_Mm01_00028568 predicted 4043
8 SASI_Mm01_00028569 predicted 2809
9 SASI_Mm01_00028570 predicted 4075
10 SASI_Mm01_00028571 predicted 3937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028133 predicted 3820
2 SASI_Mm01_00028134 predicted 3834
3 SASI_Mm01_00028135 predicted 3765
4 SASI_Mm01_00028136 predicted 3548
5 SASI_Mm01_00028137 predicted 1983
6 SASI_Mm01_00028138 predicted 3680
7 SASI_Mm01_00028139 predicted 3884
8 SASI_Mm01_00028140 predicted 2653
9 SASI_Mm01_00028141 predicted 3917
10 SASI_Mm01_00028142 predicted 3777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116507 predicted 2340
2 SASI_Mm01_00116508 predicted 2353
3 SASI_Mm01_00116509 predicted 2286
4 SASI_Mm01_00116510 predicted 2058
5 SASI_Mm01_00116511 predicted 498
6 SASI_Mm01_00116512 predicted 2197
7 SASI_Mm01_00116513 predicted 2404
8 SASI_Mm01_00116514 predicted 1164
9 SASI_Mm01_00116515 predicted 2427
10 SASI_Mm01_00116516 predicted 2295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032590
KDM2B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 2B
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032590.1-1957s1c1
Sequence:CCGGCCACTTCTGCAAGGACATGAACTCGAGTTCATGTCCTTGCAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032590.1-877s1c1
Sequence:CCGGGCTGCACAATTTGGCGCTGTACTCGAGTACAGCGCCAAATTGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032590
KDM2B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 2B
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032590.1-1957s1c1
Sequence:CCGGCCACTTCTGCAAGGACATGAACTCGAGTTCATGTCCTTGCAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032590.1-877s1c1
Sequence:CCGGGCTGCACAATTTGGCGCTGTACTCGAGTACAGCGCCAAATTGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032590
KDM2B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 2B
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032590.1-1957s1c1
Sequence:CCGGCCACTTCTGCAAGGACATGAACTCGAGTTCATGTCCTTGCAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032590.1-877s1c1
Sequence:CCGGGCTGCACAATTTGGCGCTGTACTCGAGTACAGCGCCAAATTGTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005366
VALIDATED
KDM2B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-4060s1c1
Sequence:CCGGCCTTCTTCAAACGCTGTGGAACTCGAGTTCCACAGCGTTTGAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001005366.1-4269s1c1
Sequence:CCGGCGGCCTTTACAAGAAGACATTCTCGAGAATGTCTTCTTGTAAAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-4029s1c1
Sequence:CCGGGACTGCAATAAGGTCACTGATCTCGAGATCAGTGACCTTATTGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-762s1c1
Sequence:CCGGGAGATGAGCATGTCCCAGTTTCTCGAGAAACTGGGACATGCTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001005366.1-3519s21c1
Sequence:CCGGCTGAACCACTGCAAGTCTATCCTCGAGGATAGACTTGCAGTGGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001005366.1-2711s21c1
Sequence:CCGGCCTGAGGAAGAAGCGGAAATACTCGAGTATTTCCGCTTCTTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005366.1-1008s21c1
Sequence:CCGGATGAGCGTGAAAGGTTGTTTCCTCGAGGAAACAACCTTTCACGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005366
VALIDATED
KDM2B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-4060s1c1
Sequence:CCGGCCTTCTTCAAACGCTGTGGAACTCGAGTTCCACAGCGTTTGAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001005366.1-4269s1c1
Sequence:CCGGCGGCCTTTACAAGAAGACATTCTCGAGAATGTCTTCTTGTAAAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-4029s1c1
Sequence:CCGGGACTGCAATAAGGTCACTGATCTCGAGATCAGTGACCTTATTGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-762s1c1
Sequence:CCGGGAGATGAGCATGTCCCAGTTTCTCGAGAAACTGGGACATGCTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001005366.1-3519s21c1
Sequence:CCGGCTGAACCACTGCAAGTCTATCCTCGAGGATAGACTTGCAGTGGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001005366.1-2711s21c1
Sequence:CCGGCCTGAGGAAGAAGCGGAAATACTCGAGTATTTCCGCTTCTTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005366.1-1008s21c1
Sequence:CCGGATGAGCGTGAAAGGTTGTTTCCTCGAGGAAACAACCTTTCACGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005366
VALIDATED
KDM2B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-4060s1c1
Sequence:CCGGCCTTCTTCAAACGCTGTGGAACTCGAGTTCCACAGCGTTTGAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118437    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001005366.1-4269s1c1
Sequence:CCGGCGGCCTTTACAAGAAGACATTCTCGAGAATGTCTTCTTGTAAAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-4029s1c1
Sequence:CCGGGACTGCAATAAGGTCACTGATCTCGAGATCAGTGACCTTATTGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005366.1-762s1c1
Sequence:CCGGGAGATGAGCATGTCCCAGTTTCTCGAGAAACTGGGACATGCTCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001005366.1-3519s21c1
Sequence:CCGGCTGAACCACTGCAAGTCTATCCTCGAGGATAGACTTGCAGTGGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001005366.1-2711s21c1
Sequence:CCGGCCTGAGGAAGAAGCGGAAATACTCGAGTATTTCCGCTTCTTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005366.1-1008s21c1
Sequence:CCGGATGAGCGTGAAAGGTTGTTTCCTCGAGGAAACAACCTTTCACGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_144523
VALIDATED
KDM2B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2335s1c1
Sequence:CCGGGCTGTGGAAATATCTGTCATACTCGAGTATGACAGATATTTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2334s1c1
Sequence:CCGGCGCTGTGGAAATATCTGTCATCTCGAGATGACAGATATTTCCACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2153s1c1
Sequence:CCGGGCGGCTCATTATTCGCCATATCTCGAGATATGGCGAATAATGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2152s1c1
Sequence:CCGGTGCGGCTCATTATTCGCCATACTCGAGTATGGCGAATAATGAGCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_144523.3-2552s1c1
Sequence:CCGGGCCTATTATTTCCCTTTGGAACTCGAGTTCCAAAGGGAAATAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_144523
VALIDATED
KDM2B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2335s1c1
Sequence:CCGGGCTGTGGAAATATCTGTCATACTCGAGTATGACAGATATTTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2334s1c1
Sequence:CCGGCGCTGTGGAAATATCTGTCATCTCGAGATGACAGATATTTCCACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2153s1c1
Sequence:CCGGGCGGCTCATTATTCGCCATATCTCGAGATATGGCGAATAATGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2152s1c1
Sequence:CCGGTGCGGCTCATTATTCGCCATACTCGAGTATGGCGAATAATGAGCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_144523.3-2552s1c1
Sequence:CCGGGCCTATTATTTCCCTTTGGAACTCGAGTTCCAAAGGGAAATAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_144523
VALIDATED
KDM2B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2335s1c1
Sequence:CCGGGCTGTGGAAATATCTGTCATACTCGAGTATGACAGATATTTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2334s1c1
Sequence:CCGGCGCTGTGGAAATATCTGTCATCTCGAGATGACAGATATTTCCACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2153s1c1
Sequence:CCGGGCGGCTCATTATTCGCCATATCTCGAGATATGGCGAATAATGAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_144523.3-2152s1c1
Sequence:CCGGTGCGGCTCATTATTCGCCATACTCGAGTATGGCGAATAATGAGCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_144523.3-2552s1c1
Sequence:CCGGGCCTATTATTTCCCTTTGGAACTCGAGTTCCAAAGGGAAATAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003953
VALIDATED
KDM2B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 2B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-1627s21c1
Sequence:CCGGTGGACTCACCTTACCGAATTTCTCGAGAAATTCGGTAAGGTGAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-3801s21c1
Sequence:CCGGGCGGCTCATTATTCGCCATATCTCGAGATATGGCGAATAATGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-1031s21c1
Sequence:CCGGGTTGGATCCATGCGGTTTATACTCGAGTATAAACCGCATGGATCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-3159s21c1
Sequence:CCGGGCGTAGTCCACCTCGTGTTATCTCGAGATAACACGAGGTGGACTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-2509s21c1
Sequence:CCGGCTGAGGAGGAAGCGGAAATACCTCGAGGTATTTCCGCTTCCTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-3982s21c1
Sequence:CCGGCGCTGTGGAAATATCTGTCATCTCGAGATGACAGATATTTCCACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-1682s21c1
Sequence:CCGGTAGAGTCCCTTCCGGAGAATACTCGAGTATTCTCCGGAAGGGACTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003953
VALIDATED
KDM2B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 2B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-1627s21c1
Sequence:CCGGTGGACTCACCTTACCGAATTTCTCGAGAAATTCGGTAAGGTGAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-3801s21c1
Sequence:CCGGGCGGCTCATTATTCGCCATATCTCGAGATATGGCGAATAATGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-1031s21c1
Sequence:CCGGGTTGGATCCATGCGGTTTATACTCGAGTATAAACCGCATGGATCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-3159s21c1
Sequence:CCGGGCGTAGTCCACCTCGTGTTATCTCGAGATAACACGAGGTGGACTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-2509s21c1
Sequence:CCGGCTGAGGAGGAAGCGGAAATACCTCGAGGTATTTCCGCTTCCTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-3982s21c1
Sequence:CCGGCGCTGTGGAAATATCTGTCATCTCGAGATGACAGATATTTCCACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-1682s21c1
Sequence:CCGGTAGAGTCCCTTCCGGAGAATACTCGAGTATTCTCCGGAAGGGACTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003953
VALIDATED
KDM2B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 2B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-1627s21c1
Sequence:CCGGTGGACTCACCTTACCGAATTTCTCGAGAAATTCGGTAAGGTGAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-3801s21c1
Sequence:CCGGGCGGCTCATTATTCGCCATATCTCGAGATATGGCGAATAATGAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-1031s21c1
Sequence:CCGGGTTGGATCCATGCGGTTTATACTCGAGTATAAACCGCATGGATCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-3159s21c1
Sequence:CCGGGCGTAGTCCACCTCGTGTTATCTCGAGATAACACGAGGTGGACTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-2509s21c1
Sequence:CCGGCTGAGGAGGAAGCGGAAATACCTCGAGGTATTTCCGCTTCCTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003953.1-3982s21c1
Sequence:CCGGCGCTGTGGAAATATCTGTCATCTCGAGATGACAGATATTTCCACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003953.1-1682s21c1
Sequence:CCGGTAGAGTCCCTTCCGGAGAATACTCGAGTATTCTCCGGAAGGGACTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)