EMAIL THIS PAGE TO A FRIEND

KDM4A

lysine (K)-specific demethylase 4A

159 Gene Product Result for
Synonyms: JHDM3A JMJD2 JMJD2A TDRD14A
UniProtKB ID: O75164, Q5VVB1
Gene ID:
Human(9682) Summary: This gene is a member of the Jumonji domain 2 (JMJD2) family and encodes a protein containing a JmjN domain, a JmjC domain, a JD2H domain, two TUDOR domains, and two PHD-type zinc fingers. This nuclear protein functions as a trimethylation-specific demethylase, converting specific trimethylated histone residues to the dimethylated form, and as a transcriptional repressor. [provided by RefSeq, Apr 2009]
Mouse(230674) lysine (K)-specific demethylase 4A
Rat(313539) lysine (K)-specific demethylase 4A
fruit fly(35744) Histone demethylase 4A
chicken(424571) lysine (K)-specific demethylase 4A
cow(512622) lysine (K)-specific demethylase 4A
Horse(100053154) lysine (K)-specific demethylase 4A
domestic cat(101081651) lysine (K)-specific demethylase 4A
dog(482530) lysine (K)-specific demethylase 4A
sheep(101111840) lysine (K)-specific demethylase 4A
Domestic Rabbit(100353935) lysine (K)-specific demethylase 4A
domestic guinea pig(100731064) lysine (K)-specific demethylase 4A
naked mole-rat(101715237) lysine (K)-specific demethylase 4A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014663 Rosetta Predictions human pricing
NM_001107966 Rosetta Predictions rat pricing
NM_172382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346006 predicted 2004
2 SASI_Hs01_00139623 predicted 238
3 SASI_Hs01_00139624 predicted 2175
4 SASI_Hs01_00139626 predicted 1545
5 SASI_Hs01_00139627 predicted 3147
6 SASI_Hs01_00139628 predicted 1851
7 SASI_Hs02_00346007 predicted 217
8 SASI_Hs01_00139629 predicted 925
9 SASI_Hs01_00139630 predicted 3314
10 SASI_Hs01_00139631 predicted 2188
11 SASI_Hs01_00139625 predicted 2578
12 SASI_Hs01_00139632 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234045 predicted 354
2 SASI_Rn02_00234046 predicted 911
3 SASI_Rn02_00234047 predicted 2247
4 SASI_Rn02_00234048 predicted 2957
5 SASI_Rn02_00234049 predicted 2006
6 SASI_Rn02_00234050 predicted 366
7 SASI_Rn02_00234051 predicted 2087
8 SASI_Rn02_00234052 predicted 3106
9 SASI_Rn02_00234053 predicted 289
10 SASI_Rn02_00234054 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093858 predicted 2868
2 SASI_Mm01_00093859 predicted 665
3 SASI_Mm01_00093860 predicted 856
4 SASI_Mm01_00093861 predicted 2906
5 SASI_Mm01_00093862 predicted 473
6 SASI_Mm01_00093863 predicted 494
7 SASI_Mm01_00093864 predicted 387
8 SASI_Mm01_00093865 predicted 2372
9 SASI_Mm02_00343823 predicted 2984
10 SASI_Mm01_00093867 predicted 942
11 SASI_Mm01_00093866 predicted 2138
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014663
VALIDATED
KDM4A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-447s21c1
Sequence:CCGGTTCGAGAGTTCCGCAAGATAGCTCGAGCTATCTTGCGGAACTCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-2486s21c1
Sequence:CCGGGACTGCTGTTTATGCTCATTACTCGAGTAATGAGCATAAACAGCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014663.1-197s1c1
Sequence:CCGGCCGAAACTTCAGTAGATACATCTCGAGATGTATCTACTGAAGTTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-1578s1c1
Sequence:CCGGGCCTTGGATCTTTCTGTGAATCTCGAGATTCACAGAAAGATCCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-3938s1c1
Sequence:CCGGGCTGCAGTATTGAGATGCTAACTCGAGTTAGCATCTCAATACTGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-1319s1c1
Sequence:CCGGGCACCGAGTTTGTCTTGAAATCTCGAGATTTCAAGACAAACTCGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014663.1-2596s1c1
Sequence:CCGGCCCGCTTCAAACTGAAATGTACTCGAGTACATTTCAGTTTGAAGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014663.2-1515s21c1
Sequence:CCGGGTCTTACCTTCCCAGATTATTCTCGAGAATAATCTGGGAAGGTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-3529s21c1
Sequence:CCGGTAGTGAAAGGACGAGCCATTTCTCGAGAAATGGCTCGTCCTTTCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014663
VALIDATED
KDM4A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-447s21c1
Sequence:CCGGTTCGAGAGTTCCGCAAGATAGCTCGAGCTATCTTGCGGAACTCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-2486s21c1
Sequence:CCGGGACTGCTGTTTATGCTCATTACTCGAGTAATGAGCATAAACAGCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014663.1-197s1c1
Sequence:CCGGCCGAAACTTCAGTAGATACATCTCGAGATGTATCTACTGAAGTTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-1578s1c1
Sequence:CCGGGCCTTGGATCTTTCTGTGAATCTCGAGATTCACAGAAAGATCCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-3938s1c1
Sequence:CCGGGCTGCAGTATTGAGATGCTAACTCGAGTTAGCATCTCAATACTGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-1319s1c1
Sequence:CCGGGCACCGAGTTTGTCTTGAAATCTCGAGATTTCAAGACAAACTCGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014663.1-2596s1c1
Sequence:CCGGCCCGCTTCAAACTGAAATGTACTCGAGTACATTTCAGTTTGAAGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014663.2-1515s21c1
Sequence:CCGGGTCTTACCTTCCCAGATTATTCTCGAGAATAATCTGGGAAGGTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-3529s21c1
Sequence:CCGGTAGTGAAAGGACGAGCCATTTCTCGAGAAATGGCTCGTCCTTTCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014663
VALIDATED
KDM4A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-447s21c1
Sequence:CCGGTTCGAGAGTTCCGCAAGATAGCTCGAGCTATCTTGCGGAACTCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-2486s21c1
Sequence:CCGGGACTGCTGTTTATGCTCATTACTCGAGTAATGAGCATAAACAGCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014663.1-197s1c1
Sequence:CCGGCCGAAACTTCAGTAGATACATCTCGAGATGTATCTACTGAAGTTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-1578s1c1
Sequence:CCGGGCCTTGGATCTTTCTGTGAATCTCGAGATTCACAGAAAGATCCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013493    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-3938s1c1
Sequence:CCGGGCTGCAGTATTGAGATGCTAACTCGAGTTAGCATCTCAATACTGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014663.1-1319s1c1
Sequence:CCGGGCACCGAGTTTGTCTTGAAATCTCGAGATTTCAAGACAAACTCGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014663.1-2596s1c1
Sequence:CCGGCCCGCTTCAAACTGAAATGTACTCGAGTACATTTCAGTTTGAAGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014663.2-1515s21c1
Sequence:CCGGGTCTTACCTTCCCAGATTATTCTCGAGAATAATCTGGGAAGGTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014663.2-3529s21c1
Sequence:CCGGTAGTGAAAGGACGAGCCATTTCTCGAGAAATGGCTCGTCCTTTCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172382
VALIDATED
KDM4A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-526s1c1
Sequence:CCGGAGCACGTTGATGAGTGGAATACTCGAGTATTCCACTCATCAACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-264s1c1
Sequence:CCGGCGAACATCCTACGACGATATTCTCGAGAATATCGTCGTAGGATGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-423s1c1
Sequence:CCGGCCGCGATACAGTGAATTTGAACTCGAGTTCAAATTCACTGTATCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172382.1-2571s1c1
Sequence:CCGGCGCTTCAAACTGAAGTGTGTTCTCGAGAACACACTTCAGTTTGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-1636s1c1
Sequence:CCGGGCTCCACTTCATCTCAGGATTCTCGAGAATCCTGAGATGAAGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172382
VALIDATED
KDM4A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-526s1c1
Sequence:CCGGAGCACGTTGATGAGTGGAATACTCGAGTATTCCACTCATCAACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-264s1c1
Sequence:CCGGCGAACATCCTACGACGATATTCTCGAGAATATCGTCGTAGGATGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-423s1c1
Sequence:CCGGCCGCGATACAGTGAATTTGAACTCGAGTTCAAATTCACTGTATCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172382.1-2571s1c1
Sequence:CCGGCGCTTCAAACTGAAGTGTGTTCTCGAGAACACACTTCAGTTTGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-1636s1c1
Sequence:CCGGGCTCCACTTCATCTCAGGATTCTCGAGAATCCTGAGATGAAGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172382
VALIDATED
KDM4A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-526s1c1
Sequence:CCGGAGCACGTTGATGAGTGGAATACTCGAGTATTCCACTCATCAACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-264s1c1
Sequence:CCGGCGAACATCCTACGACGATATTCTCGAGAATATCGTCGTAGGATGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-423s1c1
Sequence:CCGGCCGCGATACAGTGAATTTGAACTCGAGTTCAAATTCACTGTATCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172382.1-2571s1c1
Sequence:CCGGCGCTTCAAACTGAAGTGTGTTCTCGAGAACACACTTCAGTTTGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172382.1-1636s1c1
Sequence:CCGGGCTCCACTTCATCTCAGGATTCTCGAGAATCCTGAGATGAAGTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)