EMAIL THIS PAGE TO A FRIEND

KDM4B

lysine (K)-specific demethylase 4B

86 Gene Product Result for
Synonyms: JMJD2B TDRD14B
Gene ID:
Mouse(193796) lysine (K)-specific demethylase 4B
Rat(301128) lysine (K)-specific demethylase 4B
Zebrafish(556504) lysine (K)-specific demethylase 4B
cow(508141) lysine (K)-specific demethylase 4B
domestic cat(101091764) lysine (K)-specific demethylase 4B
dog(476741) lysine (K)-specific demethylase 4B
fruit fly(318918) Histone demethylase 4B
chicken(428354) lysine (K)-specific demethylase 4B
domestic guinea pig(100733163) lysine (K)-specific demethylase 4B
naked mole-rat(101718659) lysine (K)-specific demethylase 4B
sheep(101110232) lysine (K)-specific demethylase 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015015 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015015 Rosetta Predictions human pricing
NM_001044236 Rosetta Predictions rat pricing
XR_005737 Rosetta Predictions rat pricing
NM_172132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012864 predicted 454
2 SASI_Hs01_00012865 predicted 296
3 SASI_Hs01_00012866 predicted 928
4 SASI_Hs01_00012867 predicted 3226
5 SASI_Hs01_00012868 predicted 1864
6 SASI_Hs02_00346788 predicted 956
7 SASI_Hs01_00012869 predicted 579
8 SASI_Hs01_00012870 predicted 622
9 SASI_Hs01_00012871 predicted 386
10 SASI_Hs01_00012872 predicted 2997
11 SASI_Hs01_00012873 predicted 2381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205087 predicted 1598
2 SASI_Rn02_00205088 predicted 340
3 SASI_Rn02_00205089 predicted 251
4 SASI_Rn02_00205090 predicted 618
5 SASI_Rn02_00205091 predicted 1017
6 SASI_Rn02_00205092 predicted 3185
7 SASI_Rn02_00205093 predicted 1098
8 SASI_Rn02_00205094 predicted 3008
9 SASI_Rn02_00205095 predicted 1827
10 SASI_Rn02_00205096 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174699 predicted 375
2 SASI_Rn01_00174700 predicted 292
3 SASI_Rn01_00174701 predicted 659
4 SASI_Rn01_00174702 predicted 1054
5 SASI_Rn01_00174703 predicted 3219
6 SASI_Rn01_00174704 predicted 4099
7 SASI_Rn01_00174705 predicted 724
8 SASI_Rn01_00174706 predicted 3040
9 SASI_Rn01_00174707 predicted 1040
10 SASI_Rn01_00174708 predicted 4557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056016 predicted 251
2 SASI_Mm01_00056017 predicted 1018
3 SASI_Mm02_00343665 predicted 2966
4 SASI_Mm01_00056018 predicted 3107
5 SASI_Mm01_00056019 predicted 1809
6 SASI_Mm01_00056021 predicted 3483
7 SASI_Mm01_00056022 predicted 685
8 SASI_Mm01_00056023 predicted 1095
9 SASI_Mm01_00056024 predicted 624
10 SASI_Mm01_00056025 predicted 2917
11 SASI_Mm01_00056020 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172132
KDM4B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-2703s21c1
Sequence:CCGGGCAGCGATGGAAACTGAAATGCTCGAGCATTTCAGTTTCCATCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-3122s21c1
Sequence:CCGGTTCGGTGGACAGACGGTAATCCTCGAGGATTACCGTCTGTCCACCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172132.1-4273s1c1
Sequence:CCGGGCCCATGTGTACTTGGAAATTCTCGAGAATTTCCAAGTACACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-2970s1c1
Sequence:CCGGGCAGACATTCTACGAGGTCAACTCGAGTTGACCTCGTAGAATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-1812s1c1
Sequence:CCGGGCCCATTATCCCAATGCTGTACTCGAGTACAGCATTGGGATAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-2954s21c1
Sequence:CCGGACCGCAATGGGCTCTACTATCCTCGAGGATAGTAGAGCCCATTGCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-1284s1c1
Sequence:CCGGGCGCAGACAAATTAGTGTGAACTCGAGTTCACACTAATTTGTCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-674s1c1
Sequence:CCGGCCATCATTGAGGGCGTGAATACTCGAGTATTCACGCCCTCAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172132
KDM4B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-2703s21c1
Sequence:CCGGGCAGCGATGGAAACTGAAATGCTCGAGCATTTCAGTTTCCATCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-3122s21c1
Sequence:CCGGTTCGGTGGACAGACGGTAATCCTCGAGGATTACCGTCTGTCCACCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172132.1-4273s1c1
Sequence:CCGGGCCCATGTGTACTTGGAAATTCTCGAGAATTTCCAAGTACACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-2970s1c1
Sequence:CCGGGCAGACATTCTACGAGGTCAACTCGAGTTGACCTCGTAGAATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-1812s1c1
Sequence:CCGGGCCCATTATCCCAATGCTGTACTCGAGTACAGCATTGGGATAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-2954s21c1
Sequence:CCGGACCGCAATGGGCTCTACTATCCTCGAGGATAGTAGAGCCCATTGCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-1284s1c1
Sequence:CCGGGCGCAGACAAATTAGTGTGAACTCGAGTTCACACTAATTTGTCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-674s1c1
Sequence:CCGGCCATCATTGAGGGCGTGAATACTCGAGTATTCACGCCCTCAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172132
KDM4B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-2703s21c1
Sequence:CCGGGCAGCGATGGAAACTGAAATGCTCGAGCATTTCAGTTTCCATCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-3122s21c1
Sequence:CCGGTTCGGTGGACAGACGGTAATCCTCGAGGATTACCGTCTGTCCACCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172132.1-4273s1c1
Sequence:CCGGGCCCATGTGTACTTGGAAATTCTCGAGAATTTCCAAGTACACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-2970s1c1
Sequence:CCGGGCAGACATTCTACGAGGTCAACTCGAGTTGACCTCGTAGAATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-1812s1c1
Sequence:CCGGGCCCATTATCCCAATGCTGTACTCGAGTACAGCATTGGGATAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172132.2-2954s21c1
Sequence:CCGGACCGCAATGGGCTCTACTATCCTCGAGGATAGTAGAGCCCATTGCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-1284s1c1
Sequence:CCGGGCGCAGACAAATTAGTGTGAACTCGAGTTCACACTAATTTGTCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172132.1-674s1c1
Sequence:CCGGCCATCATTGAGGGCGTGAATACTCGAGTATTCACGCCCTCAATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015015
VALIDATED
KDM4B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-3793s21c1
Sequence:GTACCGGGTGCTACTGCAATGCCCTACTCTCGAGAGTAGGGCATTGCAGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-3811s21c1
Sequence:GTACCGGACTGAGCAACCTTTGAGATTGCTCGAGCAATCTCAAAGGTTGCTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-2363s21c1
Sequence:CCGGCCGGCCACATTACCCTCCAAACTCGAGTTTGGAGGGTAATGTGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-967s21c1
Sequence:CCGGGCCCATCATCCTGAAGAAGTACTCGAGTACTTCTTCAGGATGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-572s21c1
Sequence:CCGGGATGACCTTGAACGCAAATACCTCGAGGTATTTGCGTTCAAGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-2767s21c1
Sequence:CCGGGTGGAAGCTGAAATGCGTGTACTCGAGTACACGCATTTCAGCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-468s21c1
Sequence:GTACCGGGCCTCTTCACGCAGTACAATACTCGAGTATTGTACTGCGTGAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-959s1c1
Sequence:CCGGGCCCATCATCCTGAAGAAGTACTCGAGTACTTCTTCAGGATGATGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-2759s1c1
Sequence:CCGGGTGGAAGCTGAAATGCGTGTACTCGAGTACACGCATTTCAGCTTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-2355s1c1
Sequence:CCGGCCGGCCACATTACCCTCCAAACTCGAGTTTGGAGGGTAATGTGGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015015.1-386s1c1
Sequence:CCGGGCGGCAGACGTATGATGACATCTCGAGATGTCATCATACGTCTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015015
VALIDATED
KDM4B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-3793s21c1
Sequence:GTACCGGGTGCTACTGCAATGCCCTACTCTCGAGAGTAGGGCATTGCAGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-3811s21c1
Sequence:GTACCGGACTGAGCAACCTTTGAGATTGCTCGAGCAATCTCAAAGGTTGCTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-2363s21c1
Sequence:CCGGCCGGCCACATTACCCTCCAAACTCGAGTTTGGAGGGTAATGTGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-967s21c1
Sequence:CCGGGCCCATCATCCTGAAGAAGTACTCGAGTACTTCTTCAGGATGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-572s21c1
Sequence:CCGGGATGACCTTGAACGCAAATACCTCGAGGTATTTGCGTTCAAGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-2767s21c1
Sequence:CCGGGTGGAAGCTGAAATGCGTGTACTCGAGTACACGCATTTCAGCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-468s21c1
Sequence:GTACCGGGCCTCTTCACGCAGTACAATACTCGAGTATTGTACTGCGTGAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-959s1c1
Sequence:CCGGGCCCATCATCCTGAAGAAGTACTCGAGTACTTCTTCAGGATGATGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-2759s1c1
Sequence:CCGGGTGGAAGCTGAAATGCGTGTACTCGAGTACACGCATTTCAGCTTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-2355s1c1
Sequence:CCGGCCGGCCACATTACCCTCCAAACTCGAGTTTGGAGGGTAATGTGGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015015.1-386s1c1
Sequence:CCGGGCGGCAGACGTATGATGACATCTCGAGATGTCATCATACGTCTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015015
VALIDATED
KDM4B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-3793s21c1
Sequence:GTACCGGGTGCTACTGCAATGCCCTACTCTCGAGAGTAGGGCATTGCAGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-3811s21c1
Sequence:GTACCGGACTGAGCAACCTTTGAGATTGCTCGAGCAATCTCAAAGGTTGCTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-2363s21c1
Sequence:CCGGCCGGCCACATTACCCTCCAAACTCGAGTTTGGAGGGTAATGTGGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-967s21c1
Sequence:CCGGGCCCATCATCCTGAAGAAGTACTCGAGTACTTCTTCAGGATGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015015.2-572s21c1
Sequence:CCGGGATGACCTTGAACGCAAATACCTCGAGGTATTTGCGTTCAAGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-2767s21c1
Sequence:CCGGGTGGAAGCTGAAATGCGTGTACTCGAGTACACGCATTTCAGCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015015.2-468s21c1
Sequence:GTACCGGGCCTCTTCACGCAGTACAATACTCGAGTATTGTACTGCGTGAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-959s1c1
Sequence:CCGGGCCCATCATCCTGAAGAAGTACTCGAGTACTTCTTCAGGATGATGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-2759s1c1
Sequence:CCGGGTGGAAGCTGAAATGCGTGTACTCGAGTACACGCATTTCAGCTTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015015.1-2355s1c1
Sequence:CCGGCCGGCCACATTACCCTCCAAACTCGAGTTTGGAGGGTAATGTGGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015015.1-386s1c1
Sequence:CCGGGCGGCAGACGTATGATGACATCTCGAGATGTCATCATACGTCTGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)