EMAIL THIS PAGE TO A FRIEND

KDM4D

lysine (K)-specific demethylase 4D

84 Gene Product Result for
Synonyms: JMJD2D
UniProtKB ID: Q6B0I6, B3KPC4, Q0VF39, Q9NT41, Q9NW76
Gene ID:
Mouse(244694) lysine (K)-specific demethylase 4D
Rat(689582) lysine (K)-specific demethylase 4D
domestic cat(101085402) lysine (K)-specific demethylase 4D
cow(617971) lysine (K)-specific demethylase 4D
Horse(100067461) lysine (K)-specific demethylase 4D
domestic guinea pig(100719778) lysine (K)-specific demethylase 4D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018039 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014031 MISSION® esiRNA esiRNA targeting human JMJD2D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018039 Rosetta Predictions human pricing
NM_001079712 Rosetta Predictions rat pricing
NM_173433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120512 predicted 2452
2 SASI_Hs01_00120513 predicted 2665
3 SASI_Hs01_00120514 predicted 2699
4 SASI_Hs01_00120516 predicted 2692
5 SASI_Hs01_00120517 predicted 1339
6 SASI_Hs01_00120518 predicted 1603
7 SASI_Hs01_00120521 predicted 2597
8 SASI_Hs02_00351157 predicted 2445
9 SASI_Hs02_00351158 predicted 1673
10 SASI_Hs02_00351159 predicted 2491
11 SASI_Hs01_00120515 predicted 1636
12 SASI_Hs01_00120519 predicted 1730
13 SASI_Hs01_00120520 predicted 2661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208119 predicted 371
2 SASI_Rn02_00208120 predicted 578
3 SASI_Rn02_00208121 predicted 713
4 SASI_Rn02_00208122 predicted 517
5 SASI_Rn02_00208123 predicted 1918
6 SASI_Rn02_00208124 predicted 525
7 SASI_Rn02_00208125 predicted 716
8 SASI_Rn02_00208126 predicted 360
9 SASI_Rn02_00208127 predicted 575
10 SASI_Rn02_00208128 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345318 predicted 1057
2 SASI_Mm02_00345319 predicted 857
3 SASI_Mm02_00345320 predicted 2122
4 SASI_Mm01_00191973 predicted 1697
5 SASI_Mm02_00345321 predicted 1096
6 SASI_Mm01_00191975 predicted 1889
7 SASI_Mm01_00191976 predicted 2306
8 SASI_Mm02_00345322 predicted 1058
9 SASI_Mm01_00191977 predicted 1842
10 SASI_Mm01_00191978 predicted 1648
11 SASI_Mm01_00191972 predicted 2285
12 SASI_Mm01_00191974 predicted 2324
13 SASI_Mm01_00191979 predicted 2277
14 SASI_Mm01_00191980 predicted 2422
15 SASI_Mm01_00191981 predicted 2409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173433
KDM4D MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173433.1-2243s1c1
Sequence:CCGGCCCTAAGTCCATTACCTCATACTCGAGTATGAGGTAATGGACTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1892s1c1
Sequence:CCGGCCATCAGATGTGAAAGGTGATCTCGAGATCACCTTTCACATCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1713s1c1
Sequence:CCGGACACAGAGACTATGGTGTCTACTCGAGTAGACACCATAGTCTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-2166s1c1
Sequence:CCGGCACAGCATCTTATGACAGCTTCTCGAGAAGCTGTCATAAGATGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1839s1c1
Sequence:CCGGCCACGGTAAGTAACGTTCCTTCTCGAGAAGGAACGTTACTTACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173433
KDM4D MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173433.1-2243s1c1
Sequence:CCGGCCCTAAGTCCATTACCTCATACTCGAGTATGAGGTAATGGACTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1892s1c1
Sequence:CCGGCCATCAGATGTGAAAGGTGATCTCGAGATCACCTTTCACATCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1713s1c1
Sequence:CCGGACACAGAGACTATGGTGTCTACTCGAGTAGACACCATAGTCTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-2166s1c1
Sequence:CCGGCACAGCATCTTATGACAGCTTCTCGAGAAGCTGTCATAAGATGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1839s1c1
Sequence:CCGGCCACGGTAAGTAACGTTCCTTCTCGAGAAGGAACGTTACTTACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173433
KDM4D MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173433.1-2243s1c1
Sequence:CCGGCCCTAAGTCCATTACCTCATACTCGAGTATGAGGTAATGGACTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1892s1c1
Sequence:CCGGCCATCAGATGTGAAAGGTGATCTCGAGATCACCTTTCACATCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1713s1c1
Sequence:CCGGACACAGAGACTATGGTGTCTACTCGAGTAGACACCATAGTCTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-2166s1c1
Sequence:CCGGCACAGCATCTTATGACAGCTTCTCGAGAAGCTGTCATAAGATGCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173433.1-1839s1c1
Sequence:CCGGCCACGGTAAGTAACGTTCCTTCTCGAGAAGGAACGTTACTTACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018039
KDM4D MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018039.2-1007s1c1
Sequence:CCGGGCCAGAGAGACCTATGATAATCTCGAGATTATCATAGGTCTCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018039.2-2156s1c1
Sequence:CCGGCAGATTATCCACCCGTCAAATCTCGAGATTTGACGGGTGGATAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018039.2-977s1c1
Sequence:CCGGGCTAAGATAATTCCACCCAAACTCGAGTTTGGGTGGAATTATCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018039.2-1217s1c1
Sequence:CCGGCGCATCTATAATTCACCGATTCTCGAGAATCGGTGAATTATAGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018039.2-2603s1c1
Sequence:CCGGCCTGGAATGTCTTTGGATATTCTCGAGAATATCCAAAGACATTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018039.2-2707s1c1
Sequence:CCGGCCTGGTATATGCAACTACCATCTCGAGATGGTAGTTGCATATACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-1219s21c1
Sequence:CCGGCATCTATAATTCACCGATTTACTCGAGTAAATCGGTGAATTATAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-1605s21c1
Sequence:CCGGGGATTCCCTTCAATCGCATAACTCGAGTTATGCGATTGAAGGGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-2156s21c1
Sequence:CCGGCAGATTATCCACCCGTCAAATCTCGAGATTTGACGGGTGGATAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018039.2-2696s21c1
Sequence:CCGGGGTTAGCGTAACCTGGTATATCTCGAGATATACCAGGTTACGCTAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018039
KDM4D MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018039.2-1007s1c1
Sequence:CCGGGCCAGAGAGACCTATGATAATCTCGAGATTATCATAGGTCTCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018039.2-2156s1c1
Sequence:CCGGCAGATTATCCACCCGTCAAATCTCGAGATTTGACGGGTGGATAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018039.2-977s1c1
Sequence:CCGGGCTAAGATAATTCCACCCAAACTCGAGTTTGGGTGGAATTATCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018039.2-1217s1c1
Sequence:CCGGCGCATCTATAATTCACCGATTCTCGAGAATCGGTGAATTATAGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018039.2-2603s1c1
Sequence:CCGGCCTGGAATGTCTTTGGATATTCTCGAGAATATCCAAAGACATTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018039.2-2707s1c1
Sequence:CCGGCCTGGTATATGCAACTACCATCTCGAGATGGTAGTTGCATATACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-1219s21c1
Sequence:CCGGCATCTATAATTCACCGATTTACTCGAGTAAATCGGTGAATTATAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-1605s21c1
Sequence:CCGGGGATTCCCTTCAATCGCATAACTCGAGTTATGCGATTGAAGGGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-2156s21c1
Sequence:CCGGCAGATTATCCACCCGTCAAATCTCGAGATTTGACGGGTGGATAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018039.2-2696s21c1
Sequence:CCGGGGTTAGCGTAACCTGGTATATCTCGAGATATACCAGGTTACGCTAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018039
KDM4D MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018039.2-1007s1c1
Sequence:CCGGGCCAGAGAGACCTATGATAATCTCGAGATTATCATAGGTCTCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018039.2-2156s1c1
Sequence:CCGGCAGATTATCCACCCGTCAAATCTCGAGATTTGACGGGTGGATAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018039.2-977s1c1
Sequence:CCGGGCTAAGATAATTCCACCCAAACTCGAGTTTGGGTGGAATTATCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018039.2-1217s1c1
Sequence:CCGGCGCATCTATAATTCACCGATTCTCGAGAATCGGTGAATTATAGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147186    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018039.2-2603s1c1
Sequence:CCGGCCTGGAATGTCTTTGGATATTCTCGAGAATATCCAAAGACATTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018039.2-2707s1c1
Sequence:CCGGCCTGGTATATGCAACTACCATCTCGAGATGGTAGTTGCATATACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-1219s21c1
Sequence:CCGGCATCTATAATTCACCGATTTACTCGAGTAAATCGGTGAATTATAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-1605s21c1
Sequence:CCGGGGATTCCCTTCAATCGCATAACTCGAGTTATGCGATTGAAGGGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018039.2-2156s21c1
Sequence:CCGGCAGATTATCCACCCGTCAAATCTCGAGATTTGACGGGTGGATAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018039.2-2696s21c1
Sequence:CCGGGGTTAGCGTAACCTGGTATATCTCGAGATATACCAGGTTACGCTAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)