EMAIL THIS PAGE TO A FRIEND

KDM5B

lysine (K)-specific demethylase 5B

77 Gene Product Result for
Synonyms: CT31 JARID1B PLU-1 PLU1 PUT1 RBBP2H1A
UniProtKB ID: Q9UGL1, O95811, Q15752, Q9Y3Q5
Gene ID:
Mouse(75605) lysine (K)-specific demethylase 5B
Rat(304809) lysine (K)-specific demethylase 5B
sheep(101110351) lysine (K)-specific demethylase 5B
Domestic Rabbit(100356218) lysine (K)-specific demethylase 5B
domestic guinea pig(100723111) lysine (K)-specific demethylase 5B
naked mole-rat(101711865) lysine (K)-specific demethylase 5B
chicken(421168) lysine (K)-specific demethylase 5B
dog(479999) lysine (K)-specific demethylase 5B
Horse(100064707) lysine (K)-specific demethylase 5B
cow(540633) lysine (K)-specific demethylase 5B
domestic cat(101101609) lysine (K)-specific demethylase 5B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006618 Rosetta Predictions human pricing
NM_001107177 Rosetta Predictions rat pricing
NM_152895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044944 predicted 3363
2 SASI_Hs01_00044945 predicted 2622
3 SASI_Hs01_00044947 predicted 1384
4 SASI_Hs01_00044948 predicted 1549
5 SASI_Hs01_00044949 predicted 2122
6 SASI_Hs01_00044950 predicted 4068
7 SASI_Hs01_00044951 predicted 1238
8 SASI_Hs01_00044952 predicted 3598
9 SASI_Hs01_00044953 predicted 938
10 SASI_Hs02_00341961 predicted 2334
11 SASI_Hs01_00044946 predicted 2793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226265 predicted 4532
2 SASI_Rn02_00226266 predicted 2426
3 SASI_Rn02_00226267 predicted 1858
4 SASI_Rn02_00226268 predicted 2368
5 SASI_Rn02_00226269 predicted 1591
6 SASI_Rn02_00226270 predicted 2738
7 SASI_Rn02_00226271 predicted 1101
8 SASI_Rn02_00226272 predicted 4124
9 SASI_Rn02_00226273 predicted 2164
10 SASI_Rn02_00226274 predicted 3884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117789 predicted 4531
2 SASI_Mm01_00117791 predicted 1589
3 SASI_Mm01_00117793 predicted 4115
4 SASI_Mm01_00117795 predicted 2066
5 SASI_Mm01_00117796 predicted 669
6 SASI_Mm01_00117794 predicted 2412
7 SASI_Mm02_00342836 predicted 3258
8 SASI_Mm02_00342837 predicted 2166
9 SASI_Mm02_00342838 predicted 1578
10 SASI_Mm02_00342839 predicted 3678
11 SASI_Mm01_00117790 predicted 1203
12 SASI_Mm01_00117792 predicted 1275
13 SASI_Mm01_00117797 predicted 2131
14 SASI_Mm01_00117798 predicted 3044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006618
VALIDATED
KDM5B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-1812s21c1
Sequence:CCGGGTGCCTGTTTACCGAACTAATCTCGAGATTAGTTCGGTAAACAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006618.3-4379s21c1
Sequence:CCGGTGAGCGGTGGGAACGAGTTAACTCGAGTTAACTCGTTCCCACCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006618.3-4852s21c1
Sequence:CCGGAGCCTGTAAACGGTGCTATTTCTCGAGAAATAGCACCGTTTACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006618.2-4676s1c1
Sequence:CCGGCCTCTCCAAGATGTGGATATACTCGAGTATATCCACATCTTGGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-3960s1c1
Sequence:CCGGGCTCCCTTACTTTAGATGATACTCGAGTATCATCTAAAGTAAGGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-4073s21c1
Sequence:CCGGGGACAACAGAACCTCATATTTCTCGAGAAATATGAGGTTCTGTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006618.3-1534s21c1
Sequence:CCGGCACATATTACTGCTGATATATCTCGAGATATATCAGCAGTAATATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-2513s1c1
Sequence:CCGGCCTGAGGAAGAGGAGTATCTTCTCGAGAAGATACTCCTCTTCCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-5366s1c1
Sequence:CCGGCGAGATGGAATTAACAGTCTTCTCGAGAAGACTGTTAATTCCATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-6072s1c1
Sequence:CCGGCCCACCAATTTGGAAGGCATTCTCGAGAATGCCTTCCAAATTGGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-1969s21c1
Sequence:CCGGATCGCTTGCTTCATCGATATTCTCGAGAATATCGATGAAGCAAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006618
VALIDATED
KDM5B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-1812s21c1
Sequence:CCGGGTGCCTGTTTACCGAACTAATCTCGAGATTAGTTCGGTAAACAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006618.3-4379s21c1
Sequence:CCGGTGAGCGGTGGGAACGAGTTAACTCGAGTTAACTCGTTCCCACCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006618.3-4852s21c1
Sequence:CCGGAGCCTGTAAACGGTGCTATTTCTCGAGAAATAGCACCGTTTACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006618.2-4676s1c1
Sequence:CCGGCCTCTCCAAGATGTGGATATACTCGAGTATATCCACATCTTGGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-3960s1c1
Sequence:CCGGGCTCCCTTACTTTAGATGATACTCGAGTATCATCTAAAGTAAGGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-4073s21c1
Sequence:CCGGGGACAACAGAACCTCATATTTCTCGAGAAATATGAGGTTCTGTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006618.3-1534s21c1
Sequence:CCGGCACATATTACTGCTGATATATCTCGAGATATATCAGCAGTAATATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-2513s1c1
Sequence:CCGGCCTGAGGAAGAGGAGTATCTTCTCGAGAAGATACTCCTCTTCCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-5366s1c1
Sequence:CCGGCGAGATGGAATTAACAGTCTTCTCGAGAAGACTGTTAATTCCATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-6072s1c1
Sequence:CCGGCCCACCAATTTGGAAGGCATTCTCGAGAATGCCTTCCAAATTGGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-1969s21c1
Sequence:CCGGATCGCTTGCTTCATCGATATTCTCGAGAATATCGATGAAGCAAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006618
VALIDATED
KDM5B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-1812s21c1
Sequence:CCGGGTGCCTGTTTACCGAACTAATCTCGAGATTAGTTCGGTAAACAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006618.3-4379s21c1
Sequence:CCGGTGAGCGGTGGGAACGAGTTAACTCGAGTTAACTCGTTCCCACCGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006618.3-4852s21c1
Sequence:CCGGAGCCTGTAAACGGTGCTATTTCTCGAGAAATAGCACCGTTTACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006618.2-4676s1c1
Sequence:CCGGCCTCTCCAAGATGTGGATATACTCGAGTATATCCACATCTTGGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-3960s1c1
Sequence:CCGGGCTCCCTTACTTTAGATGATACTCGAGTATCATCTAAAGTAAGGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-4073s21c1
Sequence:CCGGGGACAACAGAACCTCATATTTCTCGAGAAATATGAGGTTCTGTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006618.3-1534s21c1
Sequence:CCGGCACATATTACTGCTGATATATCTCGAGATATATCAGCAGTAATATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-2513s1c1
Sequence:CCGGCCTGAGGAAGAGGAGTATCTTCTCGAGAAGATACTCCTCTTCCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-5366s1c1
Sequence:CCGGCGAGATGGAATTAACAGTCTTCTCGAGAAGACTGTTAATTCCATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006618.2-6072s1c1
Sequence:CCGGCCCACCAATTTGGAAGGCATTCTCGAGAATGCCTTCCAAATTGGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_006618.3-1969s21c1
Sequence:CCGGATCGCTTGCTTCATCGATATTCTCGAGAATATCGATGAAGCAAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152895
VALIDATED
KDM5B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5B
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-381s21c1
Sequence:CCGGTTCGCTTGTGATGTCGATAAACTCGAGTTTATCGACATCACAAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-4242s21c1
Sequence:CCGGCCTGAAATTCAGGAGCTTTATCTCGAGATAAAGCTCCTGAATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152895.1-4225s1c1
Sequence:CCGGCCTGAAATTCAGGAGCTTTATCTCGAGATAAAGCTCCTGAATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152895.1-3291s1c1
Sequence:CCGGCCCAGTACATCTCAATTCTTTCTCGAGAAAGAATTGAGATGTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_152895.1-4880s1c1
Sequence:CCGGCGGTGCTATTTCTATTCCTTACTCGAGTAAGGAATAGAAATAGCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152895.1-2288s1c1
Sequence:CCGGGCCTACATCATGTGAAAGAATCTCGAGATTCTTTCACATGATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-2014s21c1
Sequence:CCGGATCGCTTGCTGCACCGTTATTCTCGAGAATAACGGTGCAGCAAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-5287s21c1
Sequence:CCGGTTTCTGGTAGGCTAGGTTTATCTCGAGATAAACCTAGCCTACCAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-5056s21c1
Sequence:CCGGTCTACTGATTACGAAGGTATTCTCGAGAATACCTTCGTAATCAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152895.2-2305s21c1
Sequence:CCGGGCCTACATCATGTGAAAGAATCTCGAGATTCTTTCACATGATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152895.1-3094s1c1
Sequence:CCGGCGGCATTCTTTGAGTAGCCTTCTCGAGAAGGCTACTCAAAGAATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152895
VALIDATED
KDM5B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5B
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-381s21c1
Sequence:CCGGTTCGCTTGTGATGTCGATAAACTCGAGTTTATCGACATCACAAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-4242s21c1
Sequence:CCGGCCTGAAATTCAGGAGCTTTATCTCGAGATAAAGCTCCTGAATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152895.1-4225s1c1
Sequence:CCGGCCTGAAATTCAGGAGCTTTATCTCGAGATAAAGCTCCTGAATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152895.1-3291s1c1
Sequence:CCGGCCCAGTACATCTCAATTCTTTCTCGAGAAAGAATTGAGATGTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_152895.1-4880s1c1
Sequence:CCGGCGGTGCTATTTCTATTCCTTACTCGAGTAAGGAATAGAAATAGCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152895.1-2288s1c1
Sequence:CCGGGCCTACATCATGTGAAAGAATCTCGAGATTCTTTCACATGATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-2014s21c1
Sequence:CCGGATCGCTTGCTGCACCGTTATTCTCGAGAATAACGGTGCAGCAAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-5287s21c1
Sequence:CCGGTTTCTGGTAGGCTAGGTTTATCTCGAGATAAACCTAGCCTACCAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-5056s21c1
Sequence:CCGGTCTACTGATTACGAAGGTATTCTCGAGAATACCTTCGTAATCAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152895.2-2305s21c1
Sequence:CCGGGCCTACATCATGTGAAAGAATCTCGAGATTCTTTCACATGATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152895.1-3094s1c1
Sequence:CCGGCGGCATTCTTTGAGTAGCCTTCTCGAGAAGGCTACTCAAAGAATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152895
VALIDATED
KDM5B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5B
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-381s21c1
Sequence:CCGGTTCGCTTGTGATGTCGATAAACTCGAGTTTATCGACATCACAAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-4242s21c1
Sequence:CCGGCCTGAAATTCAGGAGCTTTATCTCGAGATAAAGCTCCTGAATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152895.1-4225s1c1
Sequence:CCGGCCTGAAATTCAGGAGCTTTATCTCGAGATAAAGCTCCTGAATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152895.1-3291s1c1
Sequence:CCGGCCCAGTACATCTCAATTCTTTCTCGAGAAAGAATTGAGATGTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_152895.1-4880s1c1
Sequence:CCGGCGGTGCTATTTCTATTCCTTACTCGAGTAAGGAATAGAAATAGCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_152895.1-2288s1c1
Sequence:CCGGGCCTACATCATGTGAAAGAATCTCGAGATTCTTTCACATGATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-2014s21c1
Sequence:CCGGATCGCTTGCTGCACCGTTATTCTCGAGAATAACGGTGCAGCAAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-5287s21c1
Sequence:CCGGTTTCTGGTAGGCTAGGTTTATCTCGAGATAAACCTAGCCTACCAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_152895.2-5056s21c1
Sequence:CCGGTCTACTGATTACGAAGGTATTCTCGAGAATACCTTCGTAATCAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152895.2-2305s21c1
Sequence:CCGGGCCTACATCATGTGAAAGAATCTCGAGATTCTTTCACATGATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152895.1-3094s1c1
Sequence:CCGGCGGCATTCTTTGAGTAGCCTTCTCGAGAAGGCTACTCAAAGAATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)