EMAIL THIS PAGE TO A FRIEND

KDM5C

lysine (K)-specific demethylase 5C

97 Gene Product Result for
Synonyms: DXS1272E JARID1C MRXJ MRXSCJ MRXSJ SMCX XE169
Gene ID:
Human(8242) Summary: This gene is a member of the SMCY homolog family and encodes a protein with one ARID domain, one JmjC domain, one JmjN domain and two PHD-type zinc fingers. The DNA-binding motifs suggest this protein is involved in the regulation of transcription and chromatin remodeling. Mutations in this gene have been associated with X-linked mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(20591) lysine (K)-specific demethylase 5C
Zebrafish(553406) lysine (K)-specific demethylase 5C
domestic cat(101091600) lysine (K)-specific demethylase 5C
dog(491894) lysine (K)-specific demethylase 5C
Horse(100034190) lysine (K)-specific demethylase 5C
cow(281490) lysine (K)-specific demethylase 5C
domestic guinea pig(100716870) lysine (K)-specific demethylase 5C
naked mole-rat(101709640) lysine (K)-specific demethylase 5C
sheep(101121317) lysine (K)-specific demethylase 5C
Domestic Rabbit(100341721) lysine (K)-specific demethylase 5C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004187 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004187 Rosetta Predictions human pricing
NM_013668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089089 predicted 3536
2 SASI_Hs01_00089090 predicted 955
3 SASI_Hs01_00089091 predicted 1737
4 SASI_Hs01_00089092 predicted 1840
5 SASI_Hs01_00089093 predicted 2320
6 SASI_Hs01_00089094 predicted 1052
7 SASI_Hs02_00337074 predicted 775
8 SASI_Hs02_00337075 predicted 2900
9 SASI_Hs01_00089095 predicted 2228
10 SASI_Hs01_00089096 predicted 2001
11 SASI_Hs01_00089097 predicted 2558
12 SASI_Hs01_00089098 predicted 4072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170357 predicted 1294
2 SASI_Mm01_00170358 predicted 745
3 SASI_Mm01_00170359 predicted 2600
4 SASI_Mm02_00322503 predicted 777
5 SASI_Mm01_00170360 predicted 2228
6 SASI_Mm01_00170361 predicted 851
7 SASI_Mm01_00170362 predicted 950
8 SASI_Mm01_00170363 predicted 1797
9 SASI_Mm01_00170364 predicted 2782
10 SASI_Mm01_00170365 predicted 1792
11 SASI_Mm01_00170356 predicted 2590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004187
VALIDATED
KDM5C MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5C
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004187.1-1053s1c1
Sequence:CCGGGCAGTGTAACACACGTCCATTCTCGAGAATGGACGTGTGTTACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004187.1-995s1c1
Sequence:CCGGCCCACTACGAACGCATTGTTTCTCGAGAAACAATGCGTTCGTAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004187.1-1898s1c1
Sequence:CCGGGTGACAGTAAACGGCACCTAACTCGAGTTAGGTGCCGTTTACTGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004187.1-641s1c1
Sequence:CCGGTCGCAGAGAAATCGGGCATTTCTCGAGAAATGCCCGATTTCTCTGCGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-2961s21c1
Sequence:CCGGGAGCTGCTGCAGCAACTAAAGCTCGAGCTTTAGTTGCTGCAGCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-643s21c1
Sequence:CCGGTCGCAGAGAAATCGGGCATTTCTCGAGAAATGCCCGATTTCTCTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-2767s21c1
Sequence:CCGGAGTACCTGCGGTATCGGTATACTCGAGTATACCGATACCGCAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004187.2-5943s21c1
Sequence:CCGGGGTTCCAACTGAAGCCTATTTCTCGAGAAATAGGCTTCAGTTGGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-3531s21c1
Sequence:CCGGGCCACACTTGAGGCCATAATCCTCGAGGATTATGGCCTCAAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-1056s21c1
Sequence:CCGGCAGTGTAACACACGTCCATTTCTCGAGAAATGGACGTGTGTTACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-2147s21c1
Sequence:CCGGCTCACTTGCAGCAGAACATTTCTCGAGAAATGTTCTGCTGCAAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-3418s21c1
Sequence:CCGGCTAGCCCTGCTGTGGATAAAGCTCGAGCTTTATCCACAGCAGGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-998s21c1
Sequence:CCGGCCACTACGAACGCATTGTTTACTCGAGTAAACAATGCGTTCGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004187
VALIDATED
KDM5C MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5C
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004187.1-1053s1c1
Sequence:CCGGGCAGTGTAACACACGTCCATTCTCGAGAATGGACGTGTGTTACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004187.1-995s1c1
Sequence:CCGGCCCACTACGAACGCATTGTTTCTCGAGAAACAATGCGTTCGTAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004187.1-1898s1c1
Sequence:CCGGGTGACAGTAAACGGCACCTAACTCGAGTTAGGTGCCGTTTACTGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004187.1-641s1c1
Sequence:CCGGTCGCAGAGAAATCGGGCATTTCTCGAGAAATGCCCGATTTCTCTGCGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-2961s21c1
Sequence:CCGGGAGCTGCTGCAGCAACTAAAGCTCGAGCTTTAGTTGCTGCAGCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-643s21c1
Sequence:CCGGTCGCAGAGAAATCGGGCATTTCTCGAGAAATGCCCGATTTCTCTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-2767s21c1
Sequence:CCGGAGTACCTGCGGTATCGGTATACTCGAGTATACCGATACCGCAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004187.2-5943s21c1
Sequence:CCGGGGTTCCAACTGAAGCCTATTTCTCGAGAAATAGGCTTCAGTTGGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-3531s21c1
Sequence:CCGGGCCACACTTGAGGCCATAATCCTCGAGGATTATGGCCTCAAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-1056s21c1
Sequence:CCGGCAGTGTAACACACGTCCATTTCTCGAGAAATGGACGTGTGTTACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-2147s21c1
Sequence:CCGGCTCACTTGCAGCAGAACATTTCTCGAGAAATGTTCTGCTGCAAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-3418s21c1
Sequence:CCGGCTAGCCCTGCTGTGGATAAAGCTCGAGCTTTATCCACAGCAGGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-998s21c1
Sequence:CCGGCCACTACGAACGCATTGTTTACTCGAGTAAACAATGCGTTCGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004187
VALIDATED
KDM5C MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5C
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004187.1-1053s1c1
Sequence:CCGGGCAGTGTAACACACGTCCATTCTCGAGAATGGACGTGTGTTACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004187.1-995s1c1
Sequence:CCGGCCCACTACGAACGCATTGTTTCTCGAGAAACAATGCGTTCGTAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004187.1-1898s1c1
Sequence:CCGGGTGACAGTAAACGGCACCTAACTCGAGTTAGGTGCCGTTTACTGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004187.1-641s1c1
Sequence:CCGGTCGCAGAGAAATCGGGCATTTCTCGAGAAATGCCCGATTTCTCTGCGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-2961s21c1
Sequence:CCGGGAGCTGCTGCAGCAACTAAAGCTCGAGCTTTAGTTGCTGCAGCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-643s21c1
Sequence:CCGGTCGCAGAGAAATCGGGCATTTCTCGAGAAATGCCCGATTTCTCTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-2767s21c1
Sequence:CCGGAGTACCTGCGGTATCGGTATACTCGAGTATACCGATACCGCAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004187.2-5943s21c1
Sequence:CCGGGGTTCCAACTGAAGCCTATTTCTCGAGAAATAGGCTTCAGTTGGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-3531s21c1
Sequence:CCGGGCCACACTTGAGGCCATAATCCTCGAGGATTATGGCCTCAAGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004187.2-1056s21c1
Sequence:CCGGCAGTGTAACACACGTCCATTTCTCGAGAAATGGACGTGTGTTACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-2147s21c1
Sequence:CCGGCTCACTTGCAGCAGAACATTTCTCGAGAAATGTTCTGCTGCAAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-3418s21c1
Sequence:CCGGCTAGCCCTGCTGTGGATAAAGCTCGAGCTTTATCCACAGCAGGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004187.3-998s21c1
Sequence:CCGGCCACTACGAACGCATTGTTTACTCGAGTAAACAATGCGTTCGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013668
VALIDATED
KDM5C MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-765s1c1
Sequence:CCGGGCATTGTTTATCCCTATGAAACTCGAGTTTCATAGGGATAAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-764s1c1
Sequence:CCGGCGCATTGTTTATCCCTATGAACTCGAGTTCATAGGGATAAACAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013668.2-5067s1c1
Sequence:CCGGCCATCCCAAGATCGTGACTTTCTCGAGAAAGTCACGATCTTGGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-3337s1c1
Sequence:CCGGGCCCAATATCCAGTCTCTCAACTCGAGTTGAGAGACTGGATATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013668.2-749s1c1
Sequence:CCGGCGCTCTCACTATGAACGCATTCTCGAGAATGCGTTCATAGTGAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-5132s21c1
Sequence:CCGGATATTCTGACTCCAAGGTATTCTCGAGAATACCTTGGAGTCAGAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-806s21c1
Sequence:CCGGCGCATTGTTTATCCCTATGAACTCGAGTTCATAGGGATAAACAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-791s21c1
Sequence:CCGGCGCTCTCACTATGAACGCATTCTCGAGAATGCGTTCATAGTGAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-3379s21c1
Sequence:CCGGGCCCAATATCCAGTCTCTCAACTCGAGTTGAGAGACTGGATATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-1488s21c1
Sequence:CCGGAGCAAGCTACCCGGGAATATACTCGAGTATATTCCCGGGTAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013668
VALIDATED
KDM5C MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-765s1c1
Sequence:CCGGGCATTGTTTATCCCTATGAAACTCGAGTTTCATAGGGATAAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-764s1c1
Sequence:CCGGCGCATTGTTTATCCCTATGAACTCGAGTTCATAGGGATAAACAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013668.2-5067s1c1
Sequence:CCGGCCATCCCAAGATCGTGACTTTCTCGAGAAAGTCACGATCTTGGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-3337s1c1
Sequence:CCGGGCCCAATATCCAGTCTCTCAACTCGAGTTGAGAGACTGGATATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013668.2-749s1c1
Sequence:CCGGCGCTCTCACTATGAACGCATTCTCGAGAATGCGTTCATAGTGAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-5132s21c1
Sequence:CCGGATATTCTGACTCCAAGGTATTCTCGAGAATACCTTGGAGTCAGAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-806s21c1
Sequence:CCGGCGCATTGTTTATCCCTATGAACTCGAGTTCATAGGGATAAACAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-791s21c1
Sequence:CCGGCGCTCTCACTATGAACGCATTCTCGAGAATGCGTTCATAGTGAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-3379s21c1
Sequence:CCGGGCCCAATATCCAGTCTCTCAACTCGAGTTGAGAGACTGGATATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-1488s21c1
Sequence:CCGGAGCAAGCTACCCGGGAATATACTCGAGTATATTCCCGGGTAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013668
VALIDATED
KDM5C MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-765s1c1
Sequence:CCGGGCATTGTTTATCCCTATGAAACTCGAGTTTCATAGGGATAAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-764s1c1
Sequence:CCGGCGCATTGTTTATCCCTATGAACTCGAGTTCATAGGGATAAACAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013668.2-5067s1c1
Sequence:CCGGCCATCCCAAGATCGTGACTTTCTCGAGAAAGTCACGATCTTGGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013668.2-3337s1c1
Sequence:CCGGGCCCAATATCCAGTCTCTCAACTCGAGTTGAGAGACTGGATATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013668.2-749s1c1
Sequence:CCGGCGCTCTCACTATGAACGCATTCTCGAGAATGCGTTCATAGTGAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-5132s21c1
Sequence:CCGGATATTCTGACTCCAAGGTATTCTCGAGAATACCTTGGAGTCAGAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-806s21c1
Sequence:CCGGCGCATTGTTTATCCCTATGAACTCGAGTTCATAGGGATAAACAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-791s21c1
Sequence:CCGGCGCTCTCACTATGAACGCATTCTCGAGAATGCGTTCATAGTGAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-3379s21c1
Sequence:CCGGGCCCAATATCCAGTCTCTCAACTCGAGTTGAGAGACTGGATATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013668.3-1488s21c1
Sequence:CCGGAGCAAGCTACCCGGGAATATACTCGAGTATATTCCCGGGTAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)