EMAIL THIS PAGE TO A FRIEND

KDM6A

lysine (K)-specific demethylase 6A

122 Gene Product Result for
Synonyms: KABUK2 UTX bA386N14.2
UniProtKB ID: O15550, Q52LL9, Q5JVQ7
Gene ID:
Human(7403) Summary: This gene is located on the X chromosome and is the corresponding locus to a Y-linked gene which encodes a tetratricopeptide repeat (TPR) protein. The encoded protein of this gene contains a JmjC-domain and catalyzes the demethylation of tri/dimethylated histone H3. [provided by RefSeq, Nov 2009]
Mouse(22289) lysine (K)-specific demethylase 6A
Rat(100310845) lysine (K)-specific demethylase 6A
Zebrafish(569277) lysine (K)-specific demethylase 6A
cow(280952) lysine (K)-specific demethylase 6A
Horse(100059800) lysine (K)-specific demethylase 6A
domestic cat(101088307) lysine (K)-specific demethylase 6A
dog(491845) lysine (K)-specific demethylase 6A
chicken(418556) lysine (K)-specific demethylase 6A
domestic guinea pig(100713465) lysine (K)-specific demethylase 6A
naked mole-rat(101727264) lysine (K)-specific demethylase 6A
sheep(101103543) lysine (K)-specific demethylase 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702123 Anti-KDM6A antibody produced in rabbit human, mouse
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA002111 ANTI-KDM6A antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB2108391 Anti-UTX antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, human, mouse
western blot pricing
SAB2102665 Anti-UTX antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse, human, rabbit, rat, canine
western blot pricing
SAB2106302 Anti-UTX antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, rabbit, mouse, human
ELISA, western blot pricing
SAB2702300 Monoclonal Anti-KDM6A antibody produced in mouse clone GT1612, affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021140 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021140 Rosetta Predictions human pricing
NM_009483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354665 predicted 819
2 SASI_Hs01_00152040 predicted 2492
3 SASI_Hs02_00354666 predicted 4165
4 SASI_Hs01_00152041 predicted 3254
5 SASI_Hs01_00152043 predicted 2986
6 SASI_Hs02_00354667 predicted 2091
7 SASI_Hs01_00152044 predicted 918
8 SASI_Hs01_00152045 predicted 708
9 SASI_Hs01_00152046 predicted 1333
10 SASI_Hs01_00152048 predicted 3739
11 SASI_Hs01_00152039 predicted 2321
12 SASI_Hs01_00152042 predicted 4064
13 SASI_Hs01_00152047 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036577 predicted 4062
2 SASI_Mm01_00036578 predicted 2576
3 SASI_Mm01_00036579 predicted 1436
4 SASI_Mm01_00036580 predicted 886
5 SASI_Mm01_00036581 predicted 680
6 SASI_Mm02_00316224 predicted 1217
7 SASI_Mm01_00036583 predicted 846
8 SASI_Mm01_00036584 predicted 4493
9 SASI_Mm01_00036585 predicted 3917
10 SASI_Mm01_00036586 predicted 4079
11 SASI_Mm01_00036582 predicted 1667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021140
KDM6A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 6A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021140.1-4813s1c1
Sequence:CCGGGCACATAGACTAAGGAATAAACTCGAGTTTATTCCTTAGTCTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-1466s1c1
Sequence:CCGGCCGCGCAAATAGAAATAATTTCTCGAGAAATTATTTCTATTTGCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-3409s1c1
Sequence:CCGGGCATGAACACAGTTCAACTATCTCGAGATAGTTGAACTGTGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-4175s1c1
Sequence:CCGGGATGCAAGTCTATGACCAATTCTCGAGAATTGGTCATAGACTTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-1197s1c1
Sequence:CCGGGCAGCACGAATTAAGTATTTACTCGAGTAAATACTTAATTCGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-3564s21c1
Sequence:CCGGTGAATCTACATCGTCAGATAACTCGAGTTATCTGACGATGTAGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-1805s21c1
Sequence:CCGGTGGAACAGCTCCGCGCAAATACTCGAGTATTTGCGCGGAGCTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-1539s21c1
Sequence:CCGGTGCACTTGCAGCACGAATTAACTCGAGTTAATTCGTGCTGCAAGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021140
KDM6A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 6A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021140.1-4813s1c1
Sequence:CCGGGCACATAGACTAAGGAATAAACTCGAGTTTATTCCTTAGTCTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-1466s1c1
Sequence:CCGGCCGCGCAAATAGAAATAATTTCTCGAGAAATTATTTCTATTTGCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-3409s1c1
Sequence:CCGGGCATGAACACAGTTCAACTATCTCGAGATAGTTGAACTGTGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-4175s1c1
Sequence:CCGGGATGCAAGTCTATGACCAATTCTCGAGAATTGGTCATAGACTTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-1197s1c1
Sequence:CCGGGCAGCACGAATTAAGTATTTACTCGAGTAAATACTTAATTCGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-3564s21c1
Sequence:CCGGTGAATCTACATCGTCAGATAACTCGAGTTATCTGACGATGTAGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-1805s21c1
Sequence:CCGGTGGAACAGCTCCGCGCAAATACTCGAGTATTTGCGCGGAGCTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-1539s21c1
Sequence:CCGGTGCACTTGCAGCACGAATTAACTCGAGTTAATTCGTGCTGCAAGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021140
KDM6A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 6A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021140.1-4813s1c1
Sequence:CCGGGCACATAGACTAAGGAATAAACTCGAGTTTATTCCTTAGTCTATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-1466s1c1
Sequence:CCGGCCGCGCAAATAGAAATAATTTCTCGAGAAATTATTTCTATTTGCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-3409s1c1
Sequence:CCGGGCATGAACACAGTTCAACTATCTCGAGATAGTTGAACTGTGTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-4175s1c1
Sequence:CCGGGATGCAAGTCTATGACCAATTCTCGAGAATTGGTCATAGACTTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021140.1-1197s1c1
Sequence:CCGGGCAGCACGAATTAAGTATTTACTCGAGTAAATACTTAATTCGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-3564s21c1
Sequence:CCGGTGAATCTACATCGTCAGATAACTCGAGTTATCTGACGATGTAGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-1805s21c1
Sequence:CCGGTGGAACAGCTCCGCGCAAATACTCGAGTATTTGCGCGGAGCTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021140.2-1539s21c1
Sequence:CCGGTGCACTTGCAGCACGAATTAACTCGAGTTAATTCGTGCTGCAAGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009483
VALIDATED
KDM6A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 6A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009483.1-2821s1c1
Sequence:CCGGCCTTCTCCTAAGTCCACTGAACTCGAGTTCAGTGGACTTAGGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-4318s1c1
Sequence:CCGGCCAGCTCATTATTGTAGTATTCTCGAGAATACTACAATAATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-581s1c1
Sequence:CCGGGCTACGAATCTCTAATCTTAACTCGAGTTAAGATTAGAGATTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-1779s1c1
Sequence:CCGGCCGAGCAAACAGAAATAATTTCTCGAGAAATTATTTCTGTTTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009483.1-5159s1c1
Sequence:CCGGGATTGCACATAGACTAAGAAACTCGAGTTTCTTAGTCTATGTGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-4088s21c1
Sequence:CCGGAGTTAGCAGTGGAACGTTATGCTCGAGCATAACGTTCCACTGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-1509s21c1
Sequence:CCGGTGGACTTGCAGCACGAATTAACTCGAGTTAATTCGTGCTGCAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009483.1-778s21c1
Sequence:CCGGGCATTTCAGTGGGCTATTAAACTCGAGTTTAATAGCCCACTGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-4731s21c1
Sequence:CCGGCTATGCCAGGACTCTCGTAAACTCGAGTTTACGAGAGTCCTGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-581s21c1
Sequence:CCGGGCTACGAATCTCTAATCTTAACTCGAGTTAAGATTAGAGATTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009483
VALIDATED
KDM6A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 6A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009483.1-2821s1c1
Sequence:CCGGCCTTCTCCTAAGTCCACTGAACTCGAGTTCAGTGGACTTAGGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-4318s1c1
Sequence:CCGGCCAGCTCATTATTGTAGTATTCTCGAGAATACTACAATAATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-581s1c1
Sequence:CCGGGCTACGAATCTCTAATCTTAACTCGAGTTAAGATTAGAGATTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-1779s1c1
Sequence:CCGGCCGAGCAAACAGAAATAATTTCTCGAGAAATTATTTCTGTTTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009483.1-5159s1c1
Sequence:CCGGGATTGCACATAGACTAAGAAACTCGAGTTTCTTAGTCTATGTGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-4088s21c1
Sequence:CCGGAGTTAGCAGTGGAACGTTATGCTCGAGCATAACGTTCCACTGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-1509s21c1
Sequence:CCGGTGGACTTGCAGCACGAATTAACTCGAGTTAATTCGTGCTGCAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009483.1-778s21c1
Sequence:CCGGGCATTTCAGTGGGCTATTAAACTCGAGTTTAATAGCCCACTGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-4731s21c1
Sequence:CCGGCTATGCCAGGACTCTCGTAAACTCGAGTTTACGAGAGTCCTGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-581s21c1
Sequence:CCGGGCTACGAATCTCTAATCTTAACTCGAGTTAAGATTAGAGATTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009483
VALIDATED
KDM6A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 6A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009483.1-2821s1c1
Sequence:CCGGCCTTCTCCTAAGTCCACTGAACTCGAGTTCAGTGGACTTAGGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-4318s1c1
Sequence:CCGGCCAGCTCATTATTGTAGTATTCTCGAGAATACTACAATAATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-581s1c1
Sequence:CCGGGCTACGAATCTCTAATCTTAACTCGAGTTAAGATTAGAGATTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009483.1-1779s1c1
Sequence:CCGGCCGAGCAAACAGAAATAATTTCTCGAGAAATTATTTCTGTTTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009483.1-5159s1c1
Sequence:CCGGGATTGCACATAGACTAAGAAACTCGAGTTTCTTAGTCTATGTGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-4088s21c1
Sequence:CCGGAGTTAGCAGTGGAACGTTATGCTCGAGCATAACGTTCCACTGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-1509s21c1
Sequence:CCGGTGGACTTGCAGCACGAATTAACTCGAGTTAATTCGTGCTGCAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009483.1-778s21c1
Sequence:CCGGGCATTTCAGTGGGCTATTAAACTCGAGTTTAATAGCCCACTGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-4731s21c1
Sequence:CCGGCTATGCCAGGACTCTCGTAAACTCGAGTTTACGAGAGTCCTGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009483.1-581s21c1
Sequence:CCGGGCTACGAATCTCTAATCTTAACTCGAGTTAAGATTAGAGATTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)