EMAIL THIS PAGE TO A FRIEND

KDM6B

lysine (K)-specific demethylase 6B

132 Gene Product Result for
Synonyms: JMJD3
UniProtKB ID: O15054, C9IZ40, Q96G33
Gene ID:
Mouse(216850) KDM1 lysine (K)-specific demethylase 6B
Rat(363630) lysine (K)-specific demethylase 6B
dog(489481) lysine (K)-specific demethylase 6B
domestic cat(101100010) lysine (K)-specific demethylase 6B
cow(100140276) lysine (K)-specific demethylase 6B
sheep(101119656) lysine (K)-specific demethylase 6B
domestic guinea pig(100733106) lysine (K)-specific demethylase 6B
naked mole-rat(101703654) lysine (K)-specific demethylase 6B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001017426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080424 Rosetta Predictions human pricing
XM_043272 Rosetta Predictions human pricing
XM_933967 Rosetta Predictions human pricing
NM_001108829 Rosetta Predictions rat pricing
NM_001017426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314716 predicted 3993
2 SASI_Hs02_00314717 predicted 4331
3 SASI_Hs02_00314718 predicted 3678
4 SASI_Hs02_00314719 predicted 4131
5 SASI_Hs02_00314720 predicted 3705
6 SASI_Hs02_00314721 predicted 4483
7 SASI_Hs02_00314722 predicted 4693
8 SASI_Hs02_00314723 predicted 4159
9 SASI_Hs02_00314724 predicted 4885
10 SASI_Hs02_00314725 predicted 4363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_043272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260161 predicted 3988
2 SASI_Hs01_00260162 predicted 4330
3 SASI_Hs01_00260163 predicted 3681
4 SASI_Hs01_00260164 predicted 4133
5 SASI_Hs01_00260165 predicted 3705
6 SASI_Hs01_00260166 predicted 4699
7 SASI_Hs01_00260167 predicted 4158
8 SASI_Hs01_00260168 predicted 633
9 SASI_Hs01_00260169 predicted 4364
10 SASI_Hs01_00260170 predicted 3819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288361 predicted 2169
2 SASI_Hs01_00288362 predicted 2504
3 SASI_Hs01_00288363 predicted 1858
4 SASI_Hs01_00288364 predicted 2306
5 SASI_Hs01_00288365 predicted 1892
6 SASI_Hs01_00288366 predicted 2871
7 SASI_Hs01_00288367 predicted 2341
8 SASI_Hs01_00288368 predicted 3059
9 SASI_Hs01_00288369 predicted 2515
10 SASI_Hs01_00288370 predicted 2543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242485 predicted 3684
2 SASI_Rn02_00242486 predicted 4098
3 SASI_Rn02_00242487 predicted 2918
4 SASI_Rn02_00242488 predicted 709
5 SASI_Rn02_00242489 predicted 3029
6 SASI_Rn02_00242490 predicted 2866
7 SASI_Rn02_00242491 predicted 3685
8 SASI_Rn02_00242492 predicted 3656
9 SASI_Rn02_00242493 predicted 3356
10 SASI_Rn02_00242494 predicted 3535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154397 predicted 4923
2 SASI_Mm01_00154398 predicted 5165
3 SASI_Mm02_00287503 predicted 3851
4 SASI_Mm01_00154400 predicted 4367
5 SASI_Mm01_00154402 predicted 5072
6 SASI_Mm01_00154403 predicted 3708
7 SASI_Mm02_00287504 predicted 749
8 SASI_Mm01_00154404 predicted 4727
9 SASI_Mm01_00154405 predicted 4780
10 SASI_Mm01_00154406 predicted 4442
11 SASI_Mm01_00154399 predicted 4150
12 SASI_Mm01_00154401 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080424
VALIDATED
KDM6B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 6B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-3987s21c1
Sequence:CCGGTCTGTACAGACCCTCGAAATCCTCGAGGATTTCGAGGGTCTGTACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-4566s21c1
Sequence:CCGGGCTCCGTCAACATCAACATTGCTCGAGCAATGTTGATGTTGACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-921s21c1
Sequence:CCGGTTGAGCACAAACGGAACTATGCTCGAGCATAGTTCCGTTTGTGCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080424.1-5991s21c1
Sequence:CCGGAGTCCCACTCACCTCTATTTACTCGAGTAAATAGAGGTGAGTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-5106s21c1
Sequence:CCGGAGTGCGATGTGGAGGTGTTTACTCGAGTAAACACCTCCACATCGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-4703s21c1
Sequence:CCGGGATCTCTATGCATCCAATATTCTCGAGAATATTGGATGCATAGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080424.1-5843s21c1
Sequence:CCGGAGATTCTTTCTATGGGCTTTACTCGAGTAAAGCCCATAGAAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080424
VALIDATED
KDM6B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 6B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-3987s21c1
Sequence:CCGGTCTGTACAGACCCTCGAAATCCTCGAGGATTTCGAGGGTCTGTACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-4566s21c1
Sequence:CCGGGCTCCGTCAACATCAACATTGCTCGAGCAATGTTGATGTTGACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-921s21c1
Sequence:CCGGTTGAGCACAAACGGAACTATGCTCGAGCATAGTTCCGTTTGTGCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080424.1-5991s21c1
Sequence:CCGGAGTCCCACTCACCTCTATTTACTCGAGTAAATAGAGGTGAGTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-5106s21c1
Sequence:CCGGAGTGCGATGTGGAGGTGTTTACTCGAGTAAACACCTCCACATCGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-4703s21c1
Sequence:CCGGGATCTCTATGCATCCAATATTCTCGAGAATATTGGATGCATAGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080424.1-5843s21c1
Sequence:CCGGAGATTCTTTCTATGGGCTTTACTCGAGTAAAGCCCATAGAAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080424
VALIDATED
KDM6B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 6B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-3987s21c1
Sequence:CCGGTCTGTACAGACCCTCGAAATCCTCGAGGATTTCGAGGGTCTGTACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-4566s21c1
Sequence:CCGGGCTCCGTCAACATCAACATTGCTCGAGCAATGTTGATGTTGACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-921s21c1
Sequence:CCGGTTGAGCACAAACGGAACTATGCTCGAGCATAGTTCCGTTTGTGCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236677    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001080424.1-5991s21c1
Sequence:CCGGAGTCCCACTCACCTCTATTTACTCGAGTAAATAGAGGTGAGTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-5106s21c1
Sequence:CCGGAGTGCGATGTGGAGGTGTTTACTCGAGTAAACACCTCCACATCGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080424.1-4703s21c1
Sequence:CCGGGATCTCTATGCATCCAATATTCTCGAGAATATTGGATGCATAGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080424.1-5843s21c1
Sequence:CCGGAGATTCTTTCTATGGGCTTTACTCGAGTAAAGCCCATAGAAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017426
VALIDATED
KDM6B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 6B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017426.1-5853s1c1
Sequence:CCGGCCTGTATATGTCTCTTGTTTACTCGAGTAAACAAGAGACATATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017426.1-5159s1c1
Sequence:CCGGCCTGTTCGTTACAAGTGAGAACTCGAGTTCTCACTTGTAACGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017426.1-2519s1c1
Sequence:CCGGGCTGGATGAATCCATTCGGAACTCGAGTTCCGAATGGATTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017426.1-3013s1c1
Sequence:CCGGCCTCGTCATCTCAGTTCTCTACTCGAGTAGAGAACTGAGATGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017426.1-2839s1c1
Sequence:CCGGCCTCTGTTCTTGAGGGACAAACTCGAGTTTGTCCCTCAAGAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017426
VALIDATED
KDM6B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 6B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017426.1-5853s1c1
Sequence:CCGGCCTGTATATGTCTCTTGTTTACTCGAGTAAACAAGAGACATATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017426.1-5159s1c1
Sequence:CCGGCCTGTTCGTTACAAGTGAGAACTCGAGTTCTCACTTGTAACGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017426.1-2519s1c1
Sequence:CCGGGCTGGATGAATCCATTCGGAACTCGAGTTCCGAATGGATTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017426.1-3013s1c1
Sequence:CCGGCCTCGTCATCTCAGTTCTCTACTCGAGTAGAGAACTGAGATGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017426.1-2839s1c1
Sequence:CCGGCCTCTGTTCTTGAGGGACAAACTCGAGTTTGTCCCTCAAGAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017426
VALIDATED
KDM6B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 6B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017426.1-5853s1c1
Sequence:CCGGCCTGTATATGTCTCTTGTTTACTCGAGTAAACAAGAGACATATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017426.1-5159s1c1
Sequence:CCGGCCTGTTCGTTACAAGTGAGAACTCGAGTTCTCACTTGTAACGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017426.1-2519s1c1
Sequence:CCGGGCTGGATGAATCCATTCGGAACTCGAGTTCCGAATGGATTCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017426.1-3013s1c1
Sequence:CCGGCCTCGTCATCTCAGTTCTCTACTCGAGTAGAGAACTGAGATGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017426.1-2839s1c1
Sequence:CCGGCCTCTGTTCTTGAGGGACAAACTCGAGTTTGTCCCTCAAGAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)