EMAIL THIS PAGE TO A FRIEND

KDM8

lysine (K)-specific demethylase 8

54 Gene Product Result for
Synonyms: JMJD5
UniProtKB ID: Q8N371, B4DLU9, Q6VAK5, Q9H8B1
Gene ID:
Human(79831) Summary: This gene likely encodes a histone lysine demethylase. Studies of a similar protein in mouse indicate a potential role for this protein as a tumor suppressor. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
Mouse(77035) lysine (K)-specific demethylase 8
Rat(308976) lysine (K)-specific demethylase 8
Zebrafish(436936) lysine (K)-specific demethylase 8
cow(507905) jumonji domain containing 5
chicken(416583) lysine (K)-specific demethylase 8
domestic cat(101096528) lysine (K)-specific demethylase 8
domestic guinea pig(100723684) lysine (K)-specific demethylase 8
naked mole-rat(101702352) lysine (K)-specific demethylase 8
sheep(101108800) lysine (K)-specific demethylase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024773 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024773 Rosetta Predictions human pricing
NM_001037196 Rosetta Predictions rat pricing
NM_029842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082888 predicted 924
2 SASI_Hs01_00082889 predicted 1453
3 SASI_Hs01_00082890 predicted 933
4 SASI_Hs01_00082891 predicted 1441
5 SASI_Hs01_00082892 predicted 373
6 SASI_Hs01_00082893 predicted 324
7 SASI_Hs01_00082894 predicted 417
8 SASI_Hs01_00082895 predicted 786
9 SASI_Hs01_00082896 predicted 495
10 SASI_Hs02_00357286 predicted 1345
11 SASI_Hs01_00082897 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204293 predicted 1026
2 SASI_Rn01_00073126 predicted 526
3 SASI_Rn01_00073128 predicted 947
4 SASI_Rn01_00073131 predicted 1315
5 SASI_Rn01_00073132 predicted 1455
6 SASI_Rn01_00073133 predicted 784
7 SASI_Rn01_00073134 predicted 1604
8 SASI_Rn01_00073135 predicted 701
9 SASI_Rn02_00204294 predicted 1009
10 SASI_Rn02_00204295 predicted 628
11 SASI_Rn01_00073127 predicted 1273
12 SASI_Rn01_00073129 predicted 1037
13 SASI_Rn01_00073130 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201657 predicted 1114
2 SASI_Mm02_00336038 predicted 1116
3 SASI_Mm01_00201659 predicted 1315
4 SASI_Mm01_00201660 predicted 795
5 SASI_Mm01_00201661 predicted 849
6 SASI_Mm01_00201663 predicted 443
7 SASI_Mm01_00201664 predicted 482
8 SASI_Mm01_00201665 predicted 1301
9 SASI_Mm01_00201666 predicted 863
10 SASI_Mm02_00336039 predicted 1126
11 SASI_Mm01_00201658 predicted 981
12 SASI_Mm01_00201662 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024773
KDM8 MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 8
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-936s1c1
Sequence:CCGGGTCAACGAGTTCATCAGCAAACTCGAGTTTGCTGATGAACTCGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024773.1-1704s1c1
Sequence:CCGGGCATCAGAAAGCCGAATGTTTCTCGAGAAACATTCGGCTTTCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-254s1c1
Sequence:CCGGGCACAGTAAAGAAGACCTGAACTCGAGTTCAGGTCTTCTTTACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-895s1c1
Sequence:CCGGCGAGGTACACAGATGAGGAATCTCGAGATTCCTCATCTGTGTACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-1077s1c1
Sequence:CCGGGAGGAGGAAATCACCATCAATCTCGAGATTGATGGTGATTTCCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-1346s1c1
Sequence:CCGGCCTGTTCATCCCGGTGAAATACTCGAGTATTTCACCGGGATGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-949s21c1
Sequence:CCGGTCAGCAAATACATCGTGAATGCTCGAGCATTCACGATGTATTTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024773.1-1773s21c1
Sequence:CCGGGGTTGGCTACCTGATTCAAACCTCGAGGTTTGAATCAGGTAGCCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1373s21c1
Sequence:CCGGTTACGTGCGGGCTCTGGATTTCTCGAGAAATCCAGAGCCCGCACGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1345s21c1
Sequence:CCGGTCCTGTTCATCCCGGTGAAATCTCGAGATTTCACCGGGATGAACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1177s21c1
Sequence:CCGGGGAAGTACATCCGGCTGTATTCTCGAGAATACAGCCGGATGTACTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024773
KDM8 MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 8
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-936s1c1
Sequence:CCGGGTCAACGAGTTCATCAGCAAACTCGAGTTTGCTGATGAACTCGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024773.1-1704s1c1
Sequence:CCGGGCATCAGAAAGCCGAATGTTTCTCGAGAAACATTCGGCTTTCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-254s1c1
Sequence:CCGGGCACAGTAAAGAAGACCTGAACTCGAGTTCAGGTCTTCTTTACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-895s1c1
Sequence:CCGGCGAGGTACACAGATGAGGAATCTCGAGATTCCTCATCTGTGTACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-1077s1c1
Sequence:CCGGGAGGAGGAAATCACCATCAATCTCGAGATTGATGGTGATTTCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-1346s1c1
Sequence:CCGGCCTGTTCATCCCGGTGAAATACTCGAGTATTTCACCGGGATGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-949s21c1
Sequence:CCGGTCAGCAAATACATCGTGAATGCTCGAGCATTCACGATGTATTTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024773.1-1773s21c1
Sequence:CCGGGGTTGGCTACCTGATTCAAACCTCGAGGTTTGAATCAGGTAGCCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1373s21c1
Sequence:CCGGTTACGTGCGGGCTCTGGATTTCTCGAGAAATCCAGAGCCCGCACGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1345s21c1
Sequence:CCGGTCCTGTTCATCCCGGTGAAATCTCGAGATTTCACCGGGATGAACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1177s21c1
Sequence:CCGGGGAAGTACATCCGGCTGTATTCTCGAGAATACAGCCGGATGTACTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024773
KDM8 MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 8
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-936s1c1
Sequence:CCGGGTCAACGAGTTCATCAGCAAACTCGAGTTTGCTGATGAACTCGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128906    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024773.1-1704s1c1
Sequence:CCGGGCATCAGAAAGCCGAATGTTTCTCGAGAAACATTCGGCTTTCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-254s1c1
Sequence:CCGGGCACAGTAAAGAAGACCTGAACTCGAGTTCAGGTCTTCTTTACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-895s1c1
Sequence:CCGGCGAGGTACACAGATGAGGAATCTCGAGATTCCTCATCTGTGTACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-1077s1c1
Sequence:CCGGGAGGAGGAAATCACCATCAATCTCGAGATTGATGGTGATTTCCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024773.1-1346s1c1
Sequence:CCGGCCTGTTCATCCCGGTGAAATACTCGAGTATTTCACCGGGATGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-949s21c1
Sequence:CCGGTCAGCAAATACATCGTGAATGCTCGAGCATTCACGATGTATTTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024773.1-1773s21c1
Sequence:CCGGGGTTGGCTACCTGATTCAAACCTCGAGGTTTGAATCAGGTAGCCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1373s21c1
Sequence:CCGGTTACGTGCGGGCTCTGGATTTCTCGAGAAATCCAGAGCCCGCACGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1345s21c1
Sequence:CCGGTCCTGTTCATCCCGGTGAAATCTCGAGATTTCACCGGGATGAACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024773.1-1177s21c1
Sequence:CCGGGGAAGTACATCCGGCTGTATTCTCGAGAATACAGCCGGATGTACTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029842
KDM8 MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029842.1-1181s1c1
Sequence:CCGGCGCACATTCTTCATAACACCACTCGAGTGGTGTTATGAAGAATGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1351s21c1
Sequence:CCGGGTCAGCTTCTGGTGGTCATAGCTCGAGCTATGACCACCAGAAGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029842.4-1304s1c1
Sequence:CCGGCTGCTAAGTACTGGCATTATGCTCGAGCATAATGCCAGTACTTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029842.4-2041s21c1
Sequence:CCGGAGGGTGAATCAAGGAGTAAATCTCGAGATTTACTCCTTGATTCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1304s21c1
Sequence:CCGGCTGCTAAGTACTGGCATTATGCTCGAGCATAATGCCAGTACTTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1021s21c1
Sequence:CCGGGAAGAGGAAGAGATCACTATCCTCGAGGATAGTGATCTCTTCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1176s21c1
Sequence:CCGGCGAGACGCACATTCTTCATAACTCGAGTTATGAAGAATGTGCGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029842
KDM8 MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029842.1-1181s1c1
Sequence:CCGGCGCACATTCTTCATAACACCACTCGAGTGGTGTTATGAAGAATGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1351s21c1
Sequence:CCGGGTCAGCTTCTGGTGGTCATAGCTCGAGCTATGACCACCAGAAGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029842.4-1304s1c1
Sequence:CCGGCTGCTAAGTACTGGCATTATGCTCGAGCATAATGCCAGTACTTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029842.4-2041s21c1
Sequence:CCGGAGGGTGAATCAAGGAGTAAATCTCGAGATTTACTCCTTGATTCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1304s21c1
Sequence:CCGGCTGCTAAGTACTGGCATTATGCTCGAGCATAATGCCAGTACTTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1021s21c1
Sequence:CCGGGAAGAGGAAGAGATCACTATCCTCGAGGATAGTGATCTCTTCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1176s21c1
Sequence:CCGGCGAGACGCACATTCTTCATAACTCGAGTTATGAAGAATGTGCGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029842
KDM8 MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029842.1-1181s1c1
Sequence:CCGGCGCACATTCTTCATAACACCACTCGAGTGGTGTTATGAAGAATGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1351s21c1
Sequence:CCGGGTCAGCTTCTGGTGGTCATAGCTCGAGCTATGACCACCAGAAGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029842.4-1304s1c1
Sequence:CCGGCTGCTAAGTACTGGCATTATGCTCGAGCATAATGCCAGTACTTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029842.4-2041s21c1
Sequence:CCGGAGGGTGAATCAAGGAGTAAATCTCGAGATTTACTCCTTGATTCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1304s21c1
Sequence:CCGGCTGCTAAGTACTGGCATTATGCTCGAGCATAATGCCAGTACTTAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1021s21c1
Sequence:CCGGGAAGAGGAAGAGATCACTATCCTCGAGGATAGTGATCTCTTCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029842.4-1176s21c1
Sequence:CCGGCGAGACGCACATTCTTCATAACTCGAGTTATGAAGAATGTGCGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)