EMAIL THIS PAGE TO A FRIEND

KDR

kinase insert domain receptor (a type III receptor tyrosine kinase)

183 Gene Product Result for
Synonyms: CD309 FLK1 VEGFR VEGFR2
UniProtKB ID: P35968, A2RRS0, B5A925, C5IFA0, O60723, Q14178
Gene ID:
Human(3791) Summary: Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
Mouse(16542) kinase insert domain protein receptor
Rat(25589) kinase insert domain receptor
Goat(100860836) kinase insert domain receptor (a type III receptor tyrosine kinase)
sheep(443087) vascular endothelial growth factor receptor-2
Domestic Rabbit(100008607) kinase insert domain receptor (a type III receptor tyrosine kinase)
domestic guinea pig(100726761) kinase insert domain receptor (a type III receptor tyrosine kinase)
naked mole-rat(101726029) kinase insert domain receptor (a type III receptor tyrosine kinase)
Zebrafish(554230) kinase insert domain receptor (a type III receptor tyrosine kinase)
cow(407170) kinase insert domain receptor (a type III receptor tyrosine kinase)
Horse(100033959) kinase insert domain receptor (a type III receptor tyrosine kinase)
domestic cat(101090260) kinase insert domain receptor (a type III receptor tyrosine kinase)
dog(482154) kinase insert domain receptor (a type III receptor tyrosine kinase)
chicken(395323) kinase insert domain receptor (a type III receptor tyrosine kinase)
Thale Cress(839585) basic helix-loop-helix protein KIDARI
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500105 Anti-FLK-1 (mouse) antibody, Rabbit monoclonal clone SP123, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4300356 Anti-KDR (Ab-1175) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
SAB4300357 Anti-KDR (Ab-1214) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry pricing
SAB4300358 Anti-KDR (Ab-951) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2900238 Anti-KDR (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2900239 Anti-KDR (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2101239 Anti-KDR antibody produced in rabbit affinity isolated antibody human, pig, horse, dog
immunohistochemistry, western blot pricing
SAB4300066 Anti-phospho-KDR (pTyr1175) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry pricing
SAB4300067 Anti-phospho-KDR (pTyr1214) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300068 Anti-phospho-KDR (pTyr951) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300656 Anti-phospho-VEGFR2 (pTyr1059) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4504007 Anti-phospho-VEGFR2 (pTyr1059) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504567 Anti-phospho-VEGFR2 (pTyr1175) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504568 Anti-phospho-VEGFR2 (pTyr1214) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504569 Anti-phospho-VEGFR2 (pTyr951) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
V1014 Anti-Vascular Endothelial Growth Factor Receptor 2 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
flow cytometry, immunohistochemistry, neutralization, western blot pricing
GW21181 Anti-VEGFR-2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300657 Anti-VEGFR2 (Ab-1059) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB1306991 ANTI-VEGFR2 (FLK1/KDR)(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501642 Anti-VEGFR2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4501643 Anti-VEGFR2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501644 Anti-VEGFR2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4501645 Anti-VEGFR2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4500965 Anti-VEGFR2 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB1306442 ANTI-VGFR2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0003791M1 Monoclonal Anti-KDR antibody produced in mouse clone 2A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404004 Monoclonal Anti-KDR antibody produced in mouse clone 4A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
V3003 Monoclonal Anti-Vascular Endothelial Growth Factor Receptor-2 (KDR) antibody produced in mouse clone 260.4, KDR-2, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
B0555 Monoclonal Anti-Vascular Endothelial Growth Factor Receptor-2 (KDR)−Biotin Conjugate antibody produced in mouse clone 260.4, KDR-2, purified immunoglobulin, buffered aqueous solution human
western blot pricing
V9134 Monoclonal Anti-Vascular Endothelial Growth Factor Receptor-2 antibody produced in mouse clone KDR-1, ascites fluid human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
07-158 Anti-KDR/Flk-1/VEGFR2 Antibody This KDR/Flk-1/VEGFR2 antibody is validated for use in WB & IHC for the detection of the KDR/Flk-1/VEGFR2 protein. pricing
07-716-I Anti-KDR/Flk-1/VEGFR2 Antibody Detect KDR/Flk-1/VEGFR2 using this rabbit polyclonal antibody, Anti-KDR/Flk-1/VEGFR2 Antibody validated for use in western blotting. pricing
05-554 Anti-KDR/Flk-1/VEGFR2 Antibody, clone CH-11 Anti-KDR/Flk-1/VEGFR2 Antibody, clone CH-11 detects level of KDR/Flk-1/VEGFR2 & has been published & validated for use in ELISA, IC & WB. pricing
ABS553 Anti-phospho KDR/FLK-1/VEGFR2 Antibody (Tyr1059) This Anti-phospho KDR/FLK-1/VEGFR2 Antibody (Tyr1059) is validated for use in western blotting & peptide inhibition assay for the detection of phospho KDR/FLK-1/VEGFR2 (Tyr1059). pricing
04-894 Anti-phospho-KDR/Flk-1/VEGFR2 (Tyr1054) Antibody, clone D1W, rabbit monoclonal This Anti-phospho-KDR/Flk-1/VEGFR2 (Tyr1054) Antibody, clone D1W is validated for use in WB for the detection of phospho-KDR/Flk-1/VEGFR2 (Tyr1054). pricing
07-374 Anti-phospho-KDR/Flk-1/VEGFR2 (Tyr1214) Antibody Anti-phospho-KDR/Flk-1/VEGFR2 (Tyr1214) Antibody detects level of phospho-KDR/Flk-1/VEGFR2 (Tyr1214) & has been published & validated for use in WB. pricing
07-722 Anti-phospho-VEGFR2/Flk-1/KDR (Tyr1054) Antibody Anti-phospho-VEGFR2/Flk-1/KDR (Tyr1054) Antibody is an antibody against phospho-VEGFR2/Flk-1/KDR (Tyr1054) for use in WB. pricing
MABS191 Anti-phospho-VEGFR2 (Tyr1212) Antibody, clone 12A10.1 This Anti-phospho-VEGFR2 (Tyr1212) Antibody, clone 12A10.1 is validated for use in WB for the detection of phospho-VEGFR2 (Tyr1212). pricing
14-630-M KDR Protein, active, 10 µg Active, N-terminal His6-tagged, recombinant, human KDR amino acids 790-end,
for use in Kinase Assays.
pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002253 Rosetta Predictions human pricing
NM_013062 Rosetta Predictions rat pricing
NM_010612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073461 predicted 4221
2 SASI_Hs01_00073462 predicted 3815
3 SASI_Hs01_00073463 predicted 4392
4 SASI_Hs01_00073464 predicted 2070
5 SASI_Hs01_00073465 predicted 2257
6 SASI_Hs02_00333501 predicted 2499
7 SASI_Hs01_00073467 predicted 2723
8 SASI_Hs01_00073470 predicted 2696
9 SASI_Hs02_00333502 predicted 1849
10 SASI_Hs02_00333503 predicted 2580
11 SASI_Hs01_00073466 predicted 2108
12 SASI_Hs01_00073468 predicted 842
13 SASI_Hs01_00073469 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112021 predicted 2528
2 SASI_Rn01_00112022 predicted 864
3 SASI_Rn01_00112024 predicted 1034
4 SASI_Rn01_00112025 predicted 2021
5 SASI_Rn02_00260801 predicted 743
6 SASI_Rn01_00112027 predicted 2038
7 SASI_Rn01_00112028 predicted 4156
8 SASI_Rn02_00260802 predicted 886
9 SASI_Rn01_00112029 predicted 853
10 SASI_Rn01_00112030 predicted 1148
11 SASI_Rn01_00112023 predicted 2396
12 SASI_Rn01_00112026 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164765 predicted 2542
2 SASI_Mm01_00164766 predicted 883
3 SASI_Mm02_00318930 predicted 3050
4 SASI_Mm01_00164767 predicted 962
5 SASI_Mm01_00164768 predicted 2042
6 SASI_Mm01_00164769 predicted 3731
7 SASI_Mm02_00318931 predicted 874
8 SASI_Mm01_00164771 predicted 2790
9 SASI_Mm01_00164772 predicted 898
10 SASI_Mm01_00164773 predicted 1392
11 SASI_Mm01_00164770 predicted 3778
12 SASI_Mm01_00164774 predicted 2905
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002253
KDR MISSION shRNA Bacterial Glycerol Stock
kinase insert domain receptor (a type III receptor tyrosine kinase)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-481s1c1
Sequence:CCGGGACTGGCTTTGGCCCAATAATCTCGAGATTATTGGGCCAAAGCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-919s1c1
Sequence:CCGGGATGAAAGTTACCAGTCTATTCTCGAGAATAGACTGGTAACTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002253.1-5245s1c1
Sequence:CCGGCTGGAATGAATACCCTCATATCTCGAGATATGAGGGTATTCATTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-2389s1c1
Sequence:CCGGCCACAGATCATGTGGTTTAAACTCGAGTTTAAACCACATGATCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-4016s1c1
Sequence:CCGGCATTTGAAGATATCCCGTTAGCTCGAGCTAACGGGATATCTTCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-1628s1c1
Sequence:CCGGCGCTGACATGTACGGTCTATGCTCGAGCATAGACCGTACATGTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-3391s1c1
Sequence:CCGGGCGGCACGAAATATCCTCTTACTCGAGTAAGAGGATATTTCGTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002253.x-5041s1c1
Sequence:CCGGGTGCTGTTTCTGACTCCTAATCTCGAGATTAGGAGTCAGAAACAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-434s1c1
Sequence:CCGGAGGCTAATACAACTCTTCAAACTCGAGTTTGAAGAGTTGTATTAGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-1537s1c1
Sequence:CCGGGTGGTCTCTCTGGTTGTGTATCTCGAGATACACAACCAGAGAGACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-855s1c1
Sequence:CCGGCTTTACTATTCCCAGCTACATCTCGAGATGTAGCTGGGAATAGTAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002253
KDR MISSION shRNA shRNA Plasmid DNA
kinase insert domain receptor (a type III receptor tyrosine kinase)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-481s1c1
Sequence:CCGGGACTGGCTTTGGCCCAATAATCTCGAGATTATTGGGCCAAAGCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-919s1c1
Sequence:CCGGGATGAAAGTTACCAGTCTATTCTCGAGAATAGACTGGTAACTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002253.1-5245s1c1
Sequence:CCGGCTGGAATGAATACCCTCATATCTCGAGATATGAGGGTATTCATTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-2389s1c1
Sequence:CCGGCCACAGATCATGTGGTTTAAACTCGAGTTTAAACCACATGATCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-4016s1c1
Sequence:CCGGCATTTGAAGATATCCCGTTAGCTCGAGCTAACGGGATATCTTCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-1628s1c1
Sequence:CCGGCGCTGACATGTACGGTCTATGCTCGAGCATAGACCGTACATGTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-3391s1c1
Sequence:CCGGGCGGCACGAAATATCCTCTTACTCGAGTAAGAGGATATTTCGTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002253.x-5041s1c1
Sequence:CCGGGTGCTGTTTCTGACTCCTAATCTCGAGATTAGGAGTCAGAAACAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-434s1c1
Sequence:CCGGAGGCTAATACAACTCTTCAAACTCGAGTTTGAAGAGTTGTATTAGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-1537s1c1
Sequence:CCGGGTGGTCTCTCTGGTTGTGTATCTCGAGATACACAACCAGAGAGACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-855s1c1
Sequence:CCGGCTTTACTATTCCCAGCTACATCTCGAGATGTAGCTGGGAATAGTAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002253
KDR MISSION shRNA Lentiviral Transduction Particles
kinase insert domain receptor (a type III receptor tyrosine kinase)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-481s1c1
Sequence:CCGGGACTGGCTTTGGCCCAATAATCTCGAGATTATTGGGCCAAAGCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-919s1c1
Sequence:CCGGGATGAAAGTTACCAGTCTATTCTCGAGAATAGACTGGTAACTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002253.1-5245s1c1
Sequence:CCGGCTGGAATGAATACCCTCATATCTCGAGATATGAGGGTATTCATTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-2389s1c1
Sequence:CCGGCCACAGATCATGTGGTTTAAACTCGAGTTTAAACCACATGATCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-4016s1c1
Sequence:CCGGCATTTGAAGATATCCCGTTAGCTCGAGCTAACGGGATATCTTCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.1-1628s1c1
Sequence:CCGGCGCTGACATGTACGGTCTATGCTCGAGCATAGACCGTACATGTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-3391s1c1
Sequence:CCGGGCGGCACGAAATATCCTCTTACTCGAGTAAGAGGATATTTCGTGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002253.x-5041s1c1
Sequence:CCGGGTGCTGTTTCTGACTCCTAATCTCGAGATTAGGAGTCAGAAACAGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-434s1c1
Sequence:CCGGAGGCTAATACAACTCTTCAAACTCGAGTTTGAAGAGTTGTATTAGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-1537s1c1
Sequence:CCGGGTGGTCTCTCTGGTTGTGTATCTCGAGATACACAACCAGAGAGACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002253.x-855s1c1
Sequence:CCGGCTTTACTATTCCCAGCTACATCTCGAGATGTAGCTGGGAATAGTAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010612
KDR MISSION shRNA Bacterial Glycerol Stock
kinase insert domain receptor (a type III receptor tyrosine kinase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-462s1c1
Sequence:CCGGCGTGATTCTGAGGAAAGGGTACTCGAGTACCCTTTCCTCAGAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2121s1c1
Sequence:CCGGGACATCTTGATTGTGGCATTTCTCGAGAAATGCCACAATCAAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2850s1c1
Sequence:CCGGGCCGTCAAGATGTTGAAAGAACTCGAGTTCTTTCAACATCTTGACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-1687s1c1
Sequence:CCGGGCCCGTATGCTTGTAAAGAATCTCGAGATTCTTTACAAGCATACGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-597s1c1
Sequence:CCGGGCCTCCACTGTTTATGTCTATCTCGAGATAGACATAAACAGTGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-3263s1c1
Sequence:CCGGGCATCTCATCTGTTACAGCTTCTCGAGAAGCTGTAACAGATGAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2676s1c1
Sequence:CCGGCCAGATGAATTGCCCTTGGATCTCGAGATCCAAGGGCAATTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-1316s1c1
Sequence:CCGGCCCTGTGAAGTATCTCAGTTACTCGAGTAACTGAGATACTTCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-4044s1c1
Sequence:CCGGCTTGCATCAGAAGAGCTGAAACTCGAGTTTCAGCTCTTCTGATGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010612
KDR MISSION shRNA shRNA Plasmid DNA
kinase insert domain receptor (a type III receptor tyrosine kinase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-462s1c1
Sequence:CCGGCGTGATTCTGAGGAAAGGGTACTCGAGTACCCTTTCCTCAGAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2121s1c1
Sequence:CCGGGACATCTTGATTGTGGCATTTCTCGAGAAATGCCACAATCAAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2850s1c1
Sequence:CCGGGCCGTCAAGATGTTGAAAGAACTCGAGTTCTTTCAACATCTTGACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-1687s1c1
Sequence:CCGGGCCCGTATGCTTGTAAAGAATCTCGAGATTCTTTACAAGCATACGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-597s1c1
Sequence:CCGGGCCTCCACTGTTTATGTCTATCTCGAGATAGACATAAACAGTGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-3263s1c1
Sequence:CCGGGCATCTCATCTGTTACAGCTTCTCGAGAAGCTGTAACAGATGAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2676s1c1
Sequence:CCGGCCAGATGAATTGCCCTTGGATCTCGAGATCCAAGGGCAATTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-1316s1c1
Sequence:CCGGCCCTGTGAAGTATCTCAGTTACTCGAGTAACTGAGATACTTCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-4044s1c1
Sequence:CCGGCTTGCATCAGAAGAGCTGAAACTCGAGTTTCAGCTCTTCTGATGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010612
KDR MISSION shRNA Lentiviral Transduction Particles
kinase insert domain receptor (a type III receptor tyrosine kinase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-462s1c1
Sequence:CCGGCGTGATTCTGAGGAAAGGGTACTCGAGTACCCTTTCCTCAGAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2121s1c1
Sequence:CCGGGACATCTTGATTGTGGCATTTCTCGAGAAATGCCACAATCAAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2850s1c1
Sequence:CCGGGCCGTCAAGATGTTGAAAGAACTCGAGTTCTTTCAACATCTTGACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-1687s1c1
Sequence:CCGGGCCCGTATGCTTGTAAAGAATCTCGAGATTCTTTACAAGCATACGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-597s1c1
Sequence:CCGGGCCTCCACTGTTTATGTCTATCTCGAGATAGACATAAACAGTGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-3263s1c1
Sequence:CCGGGCATCTCATCTGTTACAGCTTCTCGAGAAGCTGTAACAGATGAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-2676s1c1
Sequence:CCGGCCAGATGAATTGCCCTTGGATCTCGAGATCCAAGGGCAATTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-1316s1c1
Sequence:CCGGCCCTGTGAAGTATCTCAGTTACTCGAGTAACTGAGATACTTCACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010612.2-4044s1c1
Sequence:CCGGCTTGCATCAGAAGAGCTGAAACTCGAGTTTCAGCTCTTCTGATGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)