EMAIL THIS PAGE TO A FRIEND

KDSR

3-ketodihydrosphingosine reductase

86 Gene Product Result for
Synonyms: DHSR FVT1 SDR35C1
UniProtKB ID: Q06136, B2R5Y1
Gene ID:
Human(2531) Summary: The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Mouse(70750) 3-ketodihydrosphingosine reductase
Rat(360833) 3-ketodihydrosphingosine reductase
Zebrafish(394114) 3-ketodihydrosphingosine reductase
cow(505558) 3-ketodihydrosphingosine reductase
chicken(420902) 3-ketodihydrosphingosine reductase
dog(609655) 3-ketodihydrosphingosine reductase
domestic cat(101091658) 3-ketodihydrosphingosine reductase
domestic guinea pig(100731765) 3-ketodihydrosphingosine reductase
naked mole-rat(101702019) 3-ketodihydrosphingosine reductase
sheep(101119868) 3-ketodihydrosphingosine reductase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002035 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002035 Rosetta Predictions human pricing
NM_001108342 Rosetta Predictions rat pricing
NM_027534 Rosetta Predictions mouse pricing
XM_203753 Rosetta Predictions mouse pricing
XM_900177 Rosetta Predictions mouse pricing
XM_900183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112534 predicted 1227
2 SASI_Hs01_00112535 predicted 844
3 SASI_Hs01_00112536 predicted 900
4 SASI_Hs01_00112537 predicted 787
5 SASI_Hs02_00333060 predicted 550
6 SASI_Hs01_00112538 predicted 570
7 SASI_Hs01_00112540 predicted 374
8 SASI_Hs01_00112541 predicted 1161
9 SASI_Hs01_00112542 predicted 686
10 SASI_Hs01_00112543 predicted 499
11 SASI_Hs01_00112539 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237719 predicted 440
2 SASI_Rn02_00237720 predicted 368
3 SASI_Rn02_00237721 predicted 341
4 SASI_Rn02_00237722 predicted 681
5 SASI_Rn02_00237723 predicted 464
6 SASI_Rn02_00237724 predicted 304
7 SASI_Rn02_00237725 predicted 490
8 SASI_Rn02_00237726 predicted 223
9 SASI_Rn02_00237727 predicted 448
10 SASI_Rn02_00237728 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332373 predicted 351
2 SASI_Mm02_00332374 predicted 453
3 SASI_Mm02_00332375 predicted 806
4 SASI_Mm02_00332376 predicted 364
5 SASI_Mm02_00332377 predicted 548
6 SASI_Mm02_00332378 predicted 505
7 SASI_Mm02_00332379 predicted 322
8 SASI_Mm02_00332380 predicted 874
9 SASI_Mm02_00332381 predicted 248
10 SASI_Mm02_00332382 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251665 predicted 382
2 SASI_Mm01_00251666 predicted 420
3 SASI_Mm01_00251667 predicted 517
4 SASI_Mm01_00251668 predicted 433
5 SASI_Mm01_00251669 predicted 617
6 SASI_Mm01_00251670 predicted 417
7 SASI_Mm01_00251671 predicted 704
8 SASI_Mm01_00251672 predicted 763
9 SASI_Mm01_00251673 predicted 565
10 SASI_Mm01_00251674 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211892 predicted 381
2 SASI_Mm01_00211893 predicted 422
3 SASI_Mm01_00211894 predicted 432
4 SASI_Mm01_00211895 predicted 409
5 SASI_Mm01_00211896 predicted 294
6 SASI_Mm01_00211897 predicted 385
7 SASI_Mm01_00211898 predicted 307
8 SASI_Mm01_00211899 predicted 317
9 SASI_Mm01_00211900 predicted 306
10 SASI_Mm01_00211901 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255300 predicted 478
2 SASI_Mm01_00255301 predicted 403
3 SASI_Mm01_00255302 predicted 397
4 SASI_Mm01_00255303 predicted 492
5 SASI_Mm01_00255304 predicted 550
6 SASI_Mm01_00255305 predicted 358
7 SASI_Mm01_00255306 predicted 566
8 SASI_Mm01_00255307 predicted 473
9 SASI_Mm01_00255308 predicted 509
10 SASI_Mm01_00255309 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002035
VALIDATED
KDSR MISSION shRNA Bacterial Glycerol Stock
3-ketodihydrosphingosine reductase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-447s1c1
Sequence:CCGGCCAGTGGACATGCTGGTAAATCTCGAGATTTACCAGCATGTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-800s1c1
Sequence:CCGGGCCTTTGGAGACTCGACTTATCTCGAGATAAGTCGAGTCTCCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002035.1-247s1c1
Sequence:CCGGGCATTGCTATCGAGTGCTATACTCGAGTATAGCACTCGATAGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002035.1-719s1c1
Sequence:CCGGGAAGCCATATAATGTCTACATCTCGAGATGTAGACATTATATGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-458s1c1
Sequence:CCGGGCTGGTAAATTGTGCAGGAATCTCGAGATTCCTGCACAATTTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-506s21c1
Sequence:CCGGGCTGGTAAATTGTGCAGGAATCTCGAGATTCCTGCACAATTTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-495s21c1
Sequence:CCGGCCAGTGGACATGCTGGTAAATCTCGAGATTTACCAGCATGTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002035.2-1440s21c1
Sequence:CCGGAGGATTCCAGAATGATCATTACTCGAGTAATGATCATTCTGGAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-848s21c1
Sequence:CCGGGCCTTTGGAGACTCGACTTATCTCGAGATAAGTCGAGTCTCCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-295s21c1
Sequence:CCGGGCATTGCTATCGAGTGCTATACTCGAGTATAGCACTCGATAGCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002035
VALIDATED
KDSR MISSION shRNA shRNA Plasmid DNA
3-ketodihydrosphingosine reductase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-447s1c1
Sequence:CCGGCCAGTGGACATGCTGGTAAATCTCGAGATTTACCAGCATGTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-800s1c1
Sequence:CCGGGCCTTTGGAGACTCGACTTATCTCGAGATAAGTCGAGTCTCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002035.1-247s1c1
Sequence:CCGGGCATTGCTATCGAGTGCTATACTCGAGTATAGCACTCGATAGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002035.1-719s1c1
Sequence:CCGGGAAGCCATATAATGTCTACATCTCGAGATGTAGACATTATATGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-458s1c1
Sequence:CCGGGCTGGTAAATTGTGCAGGAATCTCGAGATTCCTGCACAATTTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-506s21c1
Sequence:CCGGGCTGGTAAATTGTGCAGGAATCTCGAGATTCCTGCACAATTTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-495s21c1
Sequence:CCGGCCAGTGGACATGCTGGTAAATCTCGAGATTTACCAGCATGTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002035.2-1440s21c1
Sequence:CCGGAGGATTCCAGAATGATCATTACTCGAGTAATGATCATTCTGGAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-848s21c1
Sequence:CCGGGCCTTTGGAGACTCGACTTATCTCGAGATAAGTCGAGTCTCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-295s21c1
Sequence:CCGGGCATTGCTATCGAGTGCTATACTCGAGTATAGCACTCGATAGCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002035
VALIDATED
KDSR MISSION shRNA Lentiviral Transduction Particles
3-ketodihydrosphingosine reductase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-447s1c1
Sequence:CCGGCCAGTGGACATGCTGGTAAATCTCGAGATTTACCAGCATGTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-800s1c1
Sequence:CCGGGCCTTTGGAGACTCGACTTATCTCGAGATAAGTCGAGTCTCCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_002035.1-247s1c1
Sequence:CCGGGCATTGCTATCGAGTGCTATACTCGAGTATAGCACTCGATAGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002035.1-719s1c1
Sequence:CCGGGAAGCCATATAATGTCTACATCTCGAGATGTAGACATTATATGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002035.1-458s1c1
Sequence:CCGGGCTGGTAAATTGTGCAGGAATCTCGAGATTCCTGCACAATTTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-506s21c1
Sequence:CCGGGCTGGTAAATTGTGCAGGAATCTCGAGATTCCTGCACAATTTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-495s21c1
Sequence:CCGGCCAGTGGACATGCTGGTAAATCTCGAGATTTACCAGCATGTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002035.2-1440s21c1
Sequence:CCGGAGGATTCCAGAATGATCATTACTCGAGTAATGATCATTCTGGAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-848s21c1
Sequence:CCGGGCCTTTGGAGACTCGACTTATCTCGAGATAAGTCGAGTCTCCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002035.2-295s21c1
Sequence:CCGGGCATTGCTATCGAGTGCTATACTCGAGTATAGCACTCGATAGCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027534
VALIDATED
KDSR MISSION shRNA Bacterial Glycerol Stock
3-ketodihydrosphingosine reductase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027534.2-3257s21c1
Sequence:CCGGGACATCTGACAGTACAATTAACTCGAGTTAATTGTACTGTCAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-1011s21c1
Sequence:CCGGACCTTGGAAGTTTCGATAATACTCGAGTATTATCGAAACTTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-266s21c1
Sequence:CCGGATAACTCTGGTTGCACGAAATCTCGAGATTTCGTGCAACCAGAGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-645s21c1
Sequence:CCGGCCTACTCTTCATCCAAGTTTGCTCGAGCAAACTTGGATGAAGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-367s21c1
Sequence:CCGGTGATGTGTCTCAAGACTATAACTCGAGTTATAGTCTTGAGACACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027534
VALIDATED
KDSR MISSION shRNA shRNA Plasmid DNA
3-ketodihydrosphingosine reductase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027534.2-3257s21c1
Sequence:CCGGGACATCTGACAGTACAATTAACTCGAGTTAATTGTACTGTCAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-1011s21c1
Sequence:CCGGACCTTGGAAGTTTCGATAATACTCGAGTATTATCGAAACTTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-266s21c1
Sequence:CCGGATAACTCTGGTTGCACGAAATCTCGAGATTTCGTGCAACCAGAGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-645s21c1
Sequence:CCGGCCTACTCTTCATCCAAGTTTGCTCGAGCAAACTTGGATGAAGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-367s21c1
Sequence:CCGGTGATGTGTCTCAAGACTATAACTCGAGTTATAGTCTTGAGACACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027534
VALIDATED
KDSR MISSION shRNA Lentiviral Transduction Particles
3-ketodihydrosphingosine reductase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027534.2-3257s21c1
Sequence:CCGGGACATCTGACAGTACAATTAACTCGAGTTAATTGTACTGTCAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-1011s21c1
Sequence:CCGGACCTTGGAAGTTTCGATAATACTCGAGTATTATCGAAACTTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-266s21c1
Sequence:CCGGATAACTCTGGTTGCACGAAATCTCGAGATTTCGTGCAACCAGAGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-645s21c1
Sequence:CCGGCCTACTCTTCATCCAAGTTTGCTCGAGCAAACTTGGATGAAGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027534.2-367s21c1
Sequence:CCGGTGATGTGTCTCAAGACTATAACTCGAGTTATAGTCTTGAGACACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)