EMAIL THIS PAGE TO A FRIEND

KEAP1

kelch-like ECH-associated protein 1

126 Gene Product Result for
Synonyms: INrf2 KLHL19
UniProtKB ID: Q14145, B3KPD5, Q6LEP0, Q8WTX1, Q9BPY9
Gene ID:
Human(9817) Summary: This gene encodes a protein containing KELCH-1 like domains, as well as a BTB/POZ domain. Kelch-like ECH-associated protein 1 interacts with NF-E2-related factor 2 in a redox-sensitive manner and the dissociation of the proteins in the cytoplasm is followed by transportation of NF-E2-related factor 2 to the nucleus. This interaction results in the expression of the catalytic subunit of gamma-glutamylcysteine synthetase. Two alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(50868) kelch-like ECH-associated protein 1
Rat(117519) Kelch-like ECH-associated protein 1
fruit fly(42062) CG3962 gene product from transcript CG3962-RC
cow(532791) kelch-like ECH-associated protein 1
dog(476713) kelch-like ECH-associated protein 1
domestic cat(101091260) kelch-like ECH-associated protein 1
sheep(101113845) kelch-like ECH-associated protein 1
domestic guinea pig(100713871) kelch-like ECH-associated protein 1
naked mole-rat(101718777) kelch-like ECH-associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34727 Anti-KEAP1 (AB1) antibody produced in rabbit affinity isolated antibody pig, horse, zebrafish, rat, mouse, canine, bovine, human, rabbit
immunohistochemistry, western blot pricing
AV38981 Anti-KEAP1 (AB2) antibody produced in rabbit affinity isolated antibody rabbit, rat, pig, bovine, mouse, guinea pig, horse, human
immunohistochemistry, western blot pricing
SAB2501696 Anti-KEAP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, bovine, human, rat, pig, mouse
ELISA, immunohistochemistry, western blot pricing
K3144 Anti-Keap1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunoprecipitation (IP), western blot pricing
SAB2107917 Anti-KEAP1 antibody produced in rabbit IgG fraction of antiserum zebrafish, guinea pig, mouse, rabbit, human, bovine, canine, horse, rat
immunohistochemistry, western blot pricing
HPA005558 Anti-KEAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV34728 Anti-KEAP1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder pig, mouse, rat, human, bovine, zebrafish, canine
immunohistochemistry, western blot pricing
K2769 Monoclonal Anti-Keap1 antibody produced in mouse ~1.0 mg/mL, clone Keap1-2, purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012289 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065431 MISSION® esiRNA esiRNA human KEAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012289 Rosetta Predictions human pricing
NM_203500 Rosetta Predictions human pricing
NM_057152 Rosetta Predictions rat pricing
NM_001110305 Rosetta Predictions mouse pricing
NM_001110306 Rosetta Predictions mouse pricing
NM_001110307 Rosetta Predictions mouse pricing
NM_016679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080908 predicted 1896
2 SASI_Hs01_00080909 predicted 1603
3 SASI_Hs02_00344034 predicted 718
4 SASI_Hs01_00080910 predicted 723
5 SASI_Hs01_00080911 predicted 1860
6 SASI_Hs01_00080913 predicted 932
7 SASI_Hs01_00080914 predicted 1641
8 SASI_Hs02_00344035 predicted 471
9 SASI_Hs01_00080915 predicted 899
10 SASI_Hs01_00080916 predicted 560
11 SASI_Hs01_00080907 predicted 1945
12 SASI_Hs01_00080912 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011137 predicted 1922
2 SASI_Hs01_00011138 predicted 1624
3 SASI_Hs02_00373438 predicted 745
4 SASI_Hs01_00011139 predicted 761
5 SASI_Hs01_00011140 predicted 1889
6 SASI_Hs01_00011142 predicted 958
7 SASI_Hs01_00011143 predicted 1672
8 SASI_Hs02_00373439 predicted 492
9 SASI_Hs01_00011144 predicted 922
10 SASI_Hs01_00011145 predicted 586
11 SASI_Hs01_00011136 predicted 1973
12 SASI_Hs01_00011141 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083551 predicted 814
2 SASI_Rn01_00083552 predicted 341
3 SASI_Rn01_00083553 predicted 472
4 SASI_Rn01_00083554 predicted 1834
5 SASI_Rn01_00083555 predicted 516
6 SASI_Rn01_00083556 predicted 305
7 SASI_Rn01_00083557 predicted 1563
8 SASI_Rn01_00083558 predicted 854
9 SASI_Rn01_00083559 predicted 1555
10 SASI_Rn02_00267110 predicted 686
11 SASI_Rn01_00083550 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305306 predicted 2036
2 SASI_Mm02_00305307 predicted 1330
3 SASI_Mm02_00305308 predicted 801
4 SASI_Mm02_00305309 predicted 2028
5 SASI_Mm02_00305310 predicted 818
6 SASI_Mm02_00305311 predicted 935
7 SASI_Mm02_00305312 predicted 1359
8 SASI_Mm02_00305313 predicted 1056
9 SASI_Mm02_00305314 predicted 1933
10 SASI_Mm02_00305315 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305316 predicted 1924
2 SASI_Mm02_00305317 predicted 1208
3 SASI_Mm02_00305318 predicted 689
4 SASI_Mm02_00305319 predicted 701
5 SASI_Mm02_00305320 predicted 605
6 SASI_Mm02_00305321 predicted 822
7 SASI_Mm02_00305322 predicted 1248
8 SASI_Mm02_00305323 predicted 947
9 SASI_Mm02_00305324 predicted 1816
10 SASI_Mm02_00305325 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305326 predicted 1757
2 SASI_Mm02_00305327 predicted 1048
3 SASI_Mm02_00305328 predicted 521
4 SASI_Mm02_00305329 predicted 1748
5 SASI_Mm02_00305330 predicted 534
6 SASI_Mm02_00305331 predicted 659
7 SASI_Mm02_00305332 predicted 1079
8 SASI_Mm02_00305333 predicted 779
9 SASI_Mm02_00305334 predicted 1654
10 SASI_Mm02_00305335 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110398 predicted 3076
2 SASI_Mm01_00110399 predicted 2364
3 SASI_Mm01_00110400 predicted 1833
4 SASI_Mm02_00323319 predicted 3064
5 SASI_Mm01_00110401 predicted 1851
6 SASI_Mm02_00323320 predicted 1973
7 SASI_Mm01_00110403 predicted 2397
8 SASI_Mm01_00110404 predicted 2095
9 SASI_Mm01_00110406 predicted 2974
10 SASI_Mm01_00110407 predicted 2006
11 SASI_Mm01_00110402 predicted 1251
12 SASI_Mm01_00110405 predicted 1376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016679
VALIDATED
KEAP1 MISSION shRNA Bacterial Glycerol Stock
kelch-like ECH-associated protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-3852s21c1
Sequence:CCGGCCTGCAACTCGGTGATCAATTCTCGAGAATTGATCACCGAGTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016679.4-3463s21c1
Sequence:CCGGCGGAAGCAAATTGATCAACAACTCGAGTTGTTGATCAATTTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-2367s21c1
Sequence:CCGGGTGCATCGACTGGGTCAAATACTCGAGTATTTGACCCAGTCGATGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-3116s21c1
Sequence:CCGGGGATGATCACACCGATGAATACTCGAGTATTCATCGGTGTGATCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-3003s1c1
Sequence:CCGGGCACTGACAACAGGACAGAAACTCGAGTTTCTGTCCTGTTGTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-2949s1c1
Sequence:CCGGCGGAAGCAAATTGATCAACAACTCGAGTTGTTGATCAATTTGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-2472s1c1
Sequence:CCGGCCAATGTTGACACGGAGGATTCTCGAGAATCCTCCGTGTCAACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-1380s1c1
Sequence:CCGGGCCCAATTCATGGCTCACAAACTCGAGTTTGTGAGCCATGAATTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-1497s1c1
Sequence:CCGGCCTAAGGTCATGGAAAGGCTTCTCGAGAAGCCTTTCCATGACCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016679
VALIDATED
KEAP1 MISSION shRNA shRNA Plasmid DNA
kelch-like ECH-associated protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-3852s21c1
Sequence:CCGGCCTGCAACTCGGTGATCAATTCTCGAGAATTGATCACCGAGTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016679.4-3463s21c1
Sequence:CCGGCGGAAGCAAATTGATCAACAACTCGAGTTGTTGATCAATTTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-2367s21c1
Sequence:CCGGGTGCATCGACTGGGTCAAATACTCGAGTATTTGACCCAGTCGATGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-3116s21c1
Sequence:CCGGGGATGATCACACCGATGAATACTCGAGTATTCATCGGTGTGATCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-3003s1c1
Sequence:CCGGGCACTGACAACAGGACAGAAACTCGAGTTTCTGTCCTGTTGTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-2949s1c1
Sequence:CCGGCGGAAGCAAATTGATCAACAACTCGAGTTGTTGATCAATTTGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-2472s1c1
Sequence:CCGGCCAATGTTGACACGGAGGATTCTCGAGAATCCTCCGTGTCAACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-1380s1c1
Sequence:CCGGGCCCAATTCATGGCTCACAAACTCGAGTTTGTGAGCCATGAATTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-1497s1c1
Sequence:CCGGCCTAAGGTCATGGAAAGGCTTCTCGAGAAGCCTTTCCATGACCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016679
VALIDATED
KEAP1 MISSION shRNA Lentiviral Transduction Particles
kelch-like ECH-associated protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-3852s21c1
Sequence:CCGGCCTGCAACTCGGTGATCAATTCTCGAGAATTGATCACCGAGTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016679.4-3463s21c1
Sequence:CCGGCGGAAGCAAATTGATCAACAACTCGAGTTGTTGATCAATTTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-2367s21c1
Sequence:CCGGGTGCATCGACTGGGTCAAATACTCGAGTATTTGACCCAGTCGATGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016679.4-3116s21c1
Sequence:CCGGGGATGATCACACCGATGAATACTCGAGTATTCATCGGTGTGATCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-3003s1c1
Sequence:CCGGGCACTGACAACAGGACAGAAACTCGAGTTTCTGTCCTGTTGTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-2949s1c1
Sequence:CCGGCGGAAGCAAATTGATCAACAACTCGAGTTGTTGATCAATTTGCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-2472s1c1
Sequence:CCGGCCAATGTTGACACGGAGGATTCTCGAGAATCCTCCGTGTCAACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-1380s1c1
Sequence:CCGGGCCCAATTCATGGCTCACAAACTCGAGTTTGTGAGCCATGAATTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016679.2-1497s1c1
Sequence:CCGGCCTAAGGTCATGGAAAGGCTTCTCGAGAAGCCTTTCCATGACCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012289
VALIDATED
KEAP1 MISSION shRNA Bacterial Glycerol Stock
kelch-like ECH-associated protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-1604s21c1
Sequence:CCGGGCCTTAATTCAGCTGAGTGTTCTCGAGAACACTCAGCTGAATTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-766s21c1
Sequence:CCGGCGGGAGTACATCTACATGCATCTCGAGATGCATGTAGATGTACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-1644s21c1
Sequence:CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012289.3-2117s21c1
Sequence:CCGGGCACTGCAAATAACCCATCTTCTCGAGAAGATGGGTTATTTGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012289.3-2002s1c1
Sequence:CCGGCAGATTGACCAGCAGAACTGTCTCGAGACAGTTCTGCTGGTCAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-2117s1c1
Sequence:CCGGGCACTGCAAATAACCCATCTTCTCGAGAAGATGGGTTATTTGCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1647s1c1
Sequence:CCGGGCGAATGATCACAGCAATGAACTCGAGTTCATTGCTGTGATCATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1604s1c1
Sequence:CCGGGCCTTAATTCAGCTGAGTGTTCTCGAGAACACTCAGCTGAATTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-766s1c1
Sequence:CCGGCGGGAGTACATCTACATGCATCTCGAGATGCATGTAGATGTACTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1644s1c1
Sequence:CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012289
VALIDATED
KEAP1 MISSION shRNA shRNA Plasmid DNA
kelch-like ECH-associated protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-1604s21c1
Sequence:CCGGGCCTTAATTCAGCTGAGTGTTCTCGAGAACACTCAGCTGAATTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-766s21c1
Sequence:CCGGCGGGAGTACATCTACATGCATCTCGAGATGCATGTAGATGTACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-1644s21c1
Sequence:CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012289.3-2117s21c1
Sequence:CCGGGCACTGCAAATAACCCATCTTCTCGAGAAGATGGGTTATTTGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012289.3-2002s1c1
Sequence:CCGGCAGATTGACCAGCAGAACTGTCTCGAGACAGTTCTGCTGGTCAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-2117s1c1
Sequence:CCGGGCACTGCAAATAACCCATCTTCTCGAGAAGATGGGTTATTTGCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1647s1c1
Sequence:CCGGGCGAATGATCACAGCAATGAACTCGAGTTCATTGCTGTGATCATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1604s1c1
Sequence:CCGGGCCTTAATTCAGCTGAGTGTTCTCGAGAACACTCAGCTGAATTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-766s1c1
Sequence:CCGGCGGGAGTACATCTACATGCATCTCGAGATGCATGTAGATGTACTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1644s1c1
Sequence:CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012289
VALIDATED
KEAP1 MISSION shRNA Lentiviral Transduction Particles
kelch-like ECH-associated protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-1604s21c1
Sequence:CCGGGCCTTAATTCAGCTGAGTGTTCTCGAGAACACTCAGCTGAATTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-766s21c1
Sequence:CCGGCGGGAGTACATCTACATGCATCTCGAGATGCATGTAGATGTACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012289.3-1644s21c1
Sequence:CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012289.3-2117s21c1
Sequence:CCGGGCACTGCAAATAACCCATCTTCTCGAGAAGATGGGTTATTTGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012289.3-2002s1c1
Sequence:CCGGCAGATTGACCAGCAGAACTGTCTCGAGACAGTTCTGCTGGTCAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-2117s1c1
Sequence:CCGGGCACTGCAAATAACCCATCTTCTCGAGAAGATGGGTTATTTGCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1647s1c1
Sequence:CCGGGCGAATGATCACAGCAATGAACTCGAGTTCATTGCTGTGATCATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1604s1c1
Sequence:CCGGGCCTTAATTCAGCTGAGTGTTCTCGAGAACACTCAGCTGAATTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-766s1c1
Sequence:CCGGCGGGAGTACATCTACATGCATCTCGAGATGCATGTAGATGTACTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012289.3-1644s1c1
Sequence:CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)