EMAIL THIS PAGE TO A FRIEND

KEL

Kell blood group, metallo-endopeptidase

71 Gene Product Result for
Synonyms: CD238 ECE3
UniProtKB ID: P23276, B2RBV4, Q96RS8, Q99885
Gene ID:
Human(3792) Summary: This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
Mouse(23925) Kell blood group
Rat(297025) Kell blood group, metallo-endopeptidase
dog(482743) Kell blood group, metallo-endopeptidase
chicken(418306) Kell blood group, metallo-endopeptidase
domestic cat(101098291) Kell blood group, metallo-endopeptidase
cow(529060) Kell blood group, metallo-endopeptidase
Horse(100055587) Kell blood group, metallo-endopeptidase
sheep(101121343) Kell blood group, metallo-endopeptidase
Domestic Rabbit(100339724) Kell blood group, metallo-endopeptidase
domestic guinea pig(100729473) Kell blood group, metallo-endopeptidase
naked mole-rat(101715407) Kell blood group, metallo-endopeptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000420 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000420 Rosetta Predictions human pricing
XM_001068791 Rosetta Predictions rat pricing
XM_216130 Rosetta Predictions rat pricing
NM_032540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302518 predicted 1964
2 SASI_Hs01_00144307 predicted 1751
3 SASI_Hs01_00144308 predicted 881
4 SASI_Hs01_00144309 predicted 754
5 SASI_Hs01_00144311 predicted 789
6 SASI_Hs01_00144312 predicted 945
7 SASI_Hs01_00144313 predicted 668
8 SASI_Hs01_00144314 predicted 1262
9 SASI_Hs01_00144315 predicted 1108
10 SASI_Hs01_00144316 predicted 1841
11 SASI_Hs01_00144310 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325866 predicted 2099
2 SASI_Rn02_00325867 predicted 425
3 SASI_Rn02_00325868 predicted 912
4 SASI_Rn02_00325869 predicted 412
5 SASI_Rn02_00325870 predicted 1485
6 SASI_Rn02_00325871 predicted 606
7 SASI_Rn02_00325872 predicted 1057
8 SASI_Rn02_00325873 predicted 1072
9 SASI_Rn02_00325874 predicted 996
10 SASI_Rn02_00325875 predicted 2187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376460 predicted 2097
2 SASI_Rn02_00376461 predicted 430
3 SASI_Rn02_00376462 predicted 908
4 SASI_Rn02_00376463 predicted 412
5 SASI_Rn02_00376464 predicted 1490
6 SASI_Rn02_00376465 predicted 601
7 SASI_Rn02_00376466 predicted 1058
8 SASI_Rn02_00376467 predicted 1074
9 SASI_Rn02_00376468 predicted 995
10 SASI_Rn02_00376469 predicted 2195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162280 predicted 938
2 SASI_Mm02_00337252 predicted 1929
3 SASI_Mm01_00162281 predicted 2218
4 SASI_Mm01_00162282 predicted 1701
5 SASI_Mm01_00162283 predicted 408
6 SASI_Mm01_00162284 predicted 917
7 SASI_Mm01_00162286 predicted 2108
8 SASI_Mm01_00162287 predicted 453
9 SASI_Mm01_00162288 predicted 1261
10 SASI_Mm01_00162289 predicted 634
11 SASI_Mm01_00162285 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032540
KEL MISSION shRNA Bacterial Glycerol Stock
Kell blood group, metallo-endopeptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-1517s1c1
Sequence:CCGGGCTGTCATCATACGCCTCAAACTCGAGTTTGAGGCGTATGATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-2110s1c1
Sequence:CCGGCCAGGCATATAGCAAGAGGATCTCGAGATCCTCTTGCTATATGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-1644s1c1
Sequence:CCGGCCACACAGGAATATAATGATACTCGAGTATCATTATATTCCTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-902s1c1
Sequence:CCGGGCTCAGATCCTACGGGAATATCTCGAGATATTCCCGTAGGATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-2032s1c1
Sequence:CCGGGCCTAGCATATCCTCGTTCAACTCGAGTTGAACGAGGATATGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032540
KEL MISSION shRNA shRNA Plasmid DNA
Kell blood group, metallo-endopeptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-1517s1c1
Sequence:CCGGGCTGTCATCATACGCCTCAAACTCGAGTTTGAGGCGTATGATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-2110s1c1
Sequence:CCGGCCAGGCATATAGCAAGAGGATCTCGAGATCCTCTTGCTATATGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-1644s1c1
Sequence:CCGGCCACACAGGAATATAATGATACTCGAGTATCATTATATTCCTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-902s1c1
Sequence:CCGGGCTCAGATCCTACGGGAATATCTCGAGATATTCCCGTAGGATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-2032s1c1
Sequence:CCGGGCCTAGCATATCCTCGTTCAACTCGAGTTGAACGAGGATATGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032540
KEL MISSION shRNA Lentiviral Transduction Particles
Kell blood group, metallo-endopeptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-1517s1c1
Sequence:CCGGGCTGTCATCATACGCCTCAAACTCGAGTTTGAGGCGTATGATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-2110s1c1
Sequence:CCGGCCAGGCATATAGCAAGAGGATCTCGAGATCCTCTTGCTATATGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-1644s1c1
Sequence:CCGGCCACACAGGAATATAATGATACTCGAGTATCATTATATTCCTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-902s1c1
Sequence:CCGGGCTCAGATCCTACGGGAATATCTCGAGATATTCCCGTAGGATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032540.1-2032s1c1
Sequence:CCGGGCCTAGCATATCCTCGTTCAACTCGAGTTGAACGAGGATATGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000420
KEL MISSION shRNA Bacterial Glycerol Stock
Kell blood group, metallo-endopeptidase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-1682s1c1
Sequence:CCGGCCCGACAAGAATACAACGATACTCGAGTATCGTTGTATTCTTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-749s1c1
Sequence:CCGGGCATCTCTGGTAAATGGACTTCTCGAGAAGTCCATTTACCAGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-437s1c1
Sequence:CCGGCCTGTGAGACATCTGTGTGTTCTCGAGAACACACAGATGTCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-2048s1c1
Sequence:CCGGGCCATTATGCTGCCTTTCCATCTCGAGATGGAAAGGCAGCATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-2152s1c1
Sequence:CCGGGCATACAGCAAGAGGCTGTTACTCGAGTAACAGCCTCTTGCTGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000420.2-2335s21c1
Sequence:CCGGCCAGCCTTTGCCAGGTATTTCCTCGAGGAAATACCTGGCAAAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000420.2-1820s21c1
Sequence:CCGGGGGACGTCAATGCTTACTATTCTCGAGAATAGTAAGCATTGACGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000420
KEL MISSION shRNA shRNA Plasmid DNA
Kell blood group, metallo-endopeptidase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-1682s1c1
Sequence:CCGGCCCGACAAGAATACAACGATACTCGAGTATCGTTGTATTCTTGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-749s1c1
Sequence:CCGGGCATCTCTGGTAAATGGACTTCTCGAGAAGTCCATTTACCAGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-437s1c1
Sequence:CCGGCCTGTGAGACATCTGTGTGTTCTCGAGAACACACAGATGTCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-2048s1c1
Sequence:CCGGGCCATTATGCTGCCTTTCCATCTCGAGATGGAAAGGCAGCATAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-2152s1c1
Sequence:CCGGGCATACAGCAAGAGGCTGTTACTCGAGTAACAGCCTCTTGCTGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000420.2-2335s21c1
Sequence:CCGGCCAGCCTTTGCCAGGTATTTCCTCGAGGAAATACCTGGCAAAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000420.2-1820s21c1
Sequence:CCGGGGGACGTCAATGCTTACTATTCTCGAGAATAGTAAGCATTGACGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000420
KEL MISSION shRNA Lentiviral Transduction Particles
Kell blood group, metallo-endopeptidase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-1682s1c1
Sequence:CCGGCCCGACAAGAATACAACGATACTCGAGTATCGTTGTATTCTTGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-749s1c1
Sequence:CCGGGCATCTCTGGTAAATGGACTTCTCGAGAAGTCCATTTACCAGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-437s1c1
Sequence:CCGGCCTGTGAGACATCTGTGTGTTCTCGAGAACACACAGATGTCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-2048s1c1
Sequence:CCGGGCCATTATGCTGCCTTTCCATCTCGAGATGGAAAGGCAGCATAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000420.2-2152s1c1
Sequence:CCGGGCATACAGCAAGAGGCTGTTACTCGAGTAACAGCCTCTTGCTGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000420.2-2335s21c1
Sequence:CCGGCCAGCCTTTGCCAGGTATTTCCTCGAGGAAATACCTGGCAAAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000420.2-1820s21c1
Sequence:CCGGGGGACGTCAATGCTTACTATTCTCGAGAATAGTAAGCATTGACGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)