EMAIL THIS PAGE TO A FRIEND

KERA

keratocan

48 Gene Product Result for
Synonyms: CNA2 SLRR2B
UniProtKB ID: O60938
Gene ID:
Human(11081) Summary: The protein encoded by this gene is a keratan sulfate proteoglycan that is involved in corneal transparency. Defects in this gene are a cause of autosomal recessive cornea plana 2 (CNA2).[provided by RefSeq, May 2010]
Mouse(16545) keratocan
Rat(314771) keratocan
Zebrafish(567017) keratocan
dog(482598) keratocan
chicken(373995) keratocan
cow(280785) keratocan
sheep(101112715) keratocan
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007035 Rosetta Predictions human pricing
NM_001108087 Rosetta Predictions rat pricing
NM_008438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094268 predicted 1031
2 SASI_Hs01_00094269 predicted 1500
3 SASI_Hs01_00094270 predicted 902
4 SASI_Hs02_00342814 predicted 1500
5 SASI_Hs01_00094272 predicted 978
6 SASI_Hs01_00094273 predicted 1230
7 SASI_Hs01_00094274 predicted 1288
8 SASI_Hs01_00094276 predicted 1043
9 SASI_Hs02_00342815 predicted 1217
10 SASI_Hs01_00094277 predicted 1744
11 SASI_Hs01_00094271 predicted 1724
12 SASI_Hs01_00094275 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235224 predicted 844
2 SASI_Rn02_00235225 predicted 1183
3 SASI_Rn02_00235226 predicted 1262
4 SASI_Rn02_00235227 predicted 1277
5 SASI_Rn02_00235228 predicted 464
6 SASI_Rn02_00235229 predicted 1068
7 SASI_Rn02_00235230 predicted 752
8 SASI_Rn02_00235231 predicted 1239
9 SASI_Rn02_00235232 predicted 1291
10 SASI_Rn02_00235233 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313912 predicted 375
2 SASI_Mm02_00313913 predicted 987
3 SASI_Mm02_00313914 predicted 1244
4 SASI_Mm02_00313915 predicted 729
5 SASI_Mm02_00313916 predicted 848
6 SASI_Mm02_00313917 predicted 1063
7 SASI_Mm02_00313918 predicted 747
8 SASI_Mm02_00313919 predicted 613
9 SASI_Mm02_00313920 predicted 498
10 SASI_Mm02_00313921 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008438
KERA MISSION shRNA Bacterial Glycerol Stock
keratocan
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008438.3-1177s21c1
Sequence:CCGGGCCACCGATCCCGATAGATTTCTCGAGAAATCTATCGGGATCGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008438.1-1761s1c1
Sequence:CCGGGCGAAACAATAAAGCAGTAAACTCGAGTTTACTGCTTTATTGTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-825s1c1
Sequence:CCGGGCCAACACCATGCAACTCTTTCTCGAGAAAGAGTTGCATGGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-742s1c1
Sequence:CCGGGAGATACTTTCAAGGGCCTTACTCGAGTAAGGCCCTTGAAAGTATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-608s1c1
Sequence:CCGGGCCAAGAAGTTTGGAACAATTCTCGAGAATTGTTCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-773s1c1
Sequence:CCGGGCAGTTAAATATGGCGAAGAACTCGAGTTCTTCGCCATATTTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008438
KERA MISSION shRNA shRNA Plasmid DNA
keratocan
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008438.3-1177s21c1
Sequence:CCGGGCCACCGATCCCGATAGATTTCTCGAGAAATCTATCGGGATCGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008438.1-1761s1c1
Sequence:CCGGGCGAAACAATAAAGCAGTAAACTCGAGTTTACTGCTTTATTGTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-825s1c1
Sequence:CCGGGCCAACACCATGCAACTCTTTCTCGAGAAAGAGTTGCATGGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-742s1c1
Sequence:CCGGGAGATACTTTCAAGGGCCTTACTCGAGTAAGGCCCTTGAAAGTATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-608s1c1
Sequence:CCGGGCCAAGAAGTTTGGAACAATTCTCGAGAATTGTTCCAAACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-773s1c1
Sequence:CCGGGCAGTTAAATATGGCGAAGAACTCGAGTTCTTCGCCATATTTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008438
KERA MISSION shRNA Lentiviral Transduction Particles
keratocan
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008438.3-1177s21c1
Sequence:CCGGGCCACCGATCCCGATAGATTTCTCGAGAAATCTATCGGGATCGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008438.1-1761s1c1
Sequence:CCGGGCGAAACAATAAAGCAGTAAACTCGAGTTTACTGCTTTATTGTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-825s1c1
Sequence:CCGGGCCAACACCATGCAACTCTTTCTCGAGAAAGAGTTGCATGGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-742s1c1
Sequence:CCGGGAGATACTTTCAAGGGCCTTACTCGAGTAAGGCCCTTGAAAGTATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-608s1c1
Sequence:CCGGGCCAAGAAGTTTGGAACAATTCTCGAGAATTGTTCCAAACTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008438.1-773s1c1
Sequence:CCGGGCAGTTAAATATGGCGAAGAACTCGAGTTCTTCGCCATATTTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007035
KERA MISSION shRNA Bacterial Glycerol Stock
keratocan
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007035.2-2276s1c1
Sequence:CCGGCCATTTCTTGTAGCTGTTGTTCTCGAGAACAACAGCTACAAGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-1240s1c1
Sequence:CCGGCCTCCAAGATTACCAGCCAATCTCGAGATTGGCTGGTAATCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-826s1c1
Sequence:CCGGCCTTCAAGAATTTGGTATCTTCTCGAGAAGATACCAAATTCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-899s1c1
Sequence:CCGGCCACCCAGCTAAGATGGATAACTCGAGTTATCCATCTTAGCTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-1038s1c1
Sequence:CCGGGCCAAGAAGTTTAGAACAATTCTCGAGAATTGTTCTAAACTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007035
KERA MISSION shRNA shRNA Plasmid DNA
keratocan
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007035.2-2276s1c1
Sequence:CCGGCCATTTCTTGTAGCTGTTGTTCTCGAGAACAACAGCTACAAGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-1240s1c1
Sequence:CCGGCCTCCAAGATTACCAGCCAATCTCGAGATTGGCTGGTAATCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-826s1c1
Sequence:CCGGCCTTCAAGAATTTGGTATCTTCTCGAGAAGATACCAAATTCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-899s1c1
Sequence:CCGGCCACCCAGCTAAGATGGATAACTCGAGTTATCCATCTTAGCTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-1038s1c1
Sequence:CCGGGCCAAGAAGTTTAGAACAATTCTCGAGAATTGTTCTAAACTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007035
KERA MISSION shRNA Lentiviral Transduction Particles
keratocan
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007035.2-2276s1c1
Sequence:CCGGCCATTTCTTGTAGCTGTTGTTCTCGAGAACAACAGCTACAAGAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-1240s1c1
Sequence:CCGGCCTCCAAGATTACCAGCCAATCTCGAGATTGGCTGGTAATCTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-826s1c1
Sequence:CCGGCCTTCAAGAATTTGGTATCTTCTCGAGAAGATACCAAATTCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-899s1c1
Sequence:CCGGCCACCCAGCTAAGATGGATAACTCGAGTTATCCATCTTAGCTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007035.2-1038s1c1
Sequence:CCGGGCCAAGAAGTTTAGAACAATTCTCGAGAATTGTTCTAAACTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)