EMAIL THIS PAGE TO A FRIEND

KGFLP1

126 Gene Product Result for
Species: Human KGFLP1(387628)
UniProtKB ID: Q2TVT4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174950 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003674 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380081 predicted 2471
2 SASI_Hs02_00380082 predicted 2218
3 SASI_Hs02_00380083 predicted 1463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174950
KGFLP1 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-468s1c1
Sequence:CCGGCGGTTGGGACAAGTACAGTAACTCGAGTTACTGTACTTGTCCCAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-925s1c1
Sequence:CCGGCCACTTTCTTCCTATGGCAATCTCGAGATTGCCATAGGAAGAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-752s1c1
Sequence:CCGGGCAAAGAAAGAATGCAATGAACTCGAGTTCATTGCATTCTTTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-447s1c1
Sequence:CCGGGTCTCAGCTTTCTCATCTGTACTCGAGTACAGATGAGAAAGCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-824s1c1
Sequence:CCGGGCAGCTAAATGGACACACAATCTCGAGATTGTGTGTCCATTTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-451s1c1
Sequence:CCGGCAGCTTTCTCATCTGTACGGTCTCGAGACCGTACAGATGAGAAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-1382s1c1
Sequence:CCGGGCTGGCAGGATTTGTCAGATACTCGAGTATCTGACAAATCCTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-208s1c1
Sequence:CCGGGTTTGGGATCGAGATCTGGAACTCGAGTTCCAGATCTCGATCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174950
KGFLP1 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-468s1c1
Sequence:CCGGCGGTTGGGACAAGTACAGTAACTCGAGTTACTGTACTTGTCCCAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-925s1c1
Sequence:CCGGCCACTTTCTTCCTATGGCAATCTCGAGATTGCCATAGGAAGAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-752s1c1
Sequence:CCGGGCAAAGAAAGAATGCAATGAACTCGAGTTCATTGCATTCTTTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-447s1c1
Sequence:CCGGGTCTCAGCTTTCTCATCTGTACTCGAGTACAGATGAGAAAGCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-824s1c1
Sequence:CCGGGCAGCTAAATGGACACACAATCTCGAGATTGTGTGTCCATTTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-451s1c1
Sequence:CCGGCAGCTTTCTCATCTGTACGGTCTCGAGACCGTACAGATGAGAAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-1382s1c1
Sequence:CCGGGCTGGCAGGATTTGTCAGATACTCGAGTATCTGACAAATCCTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-208s1c1
Sequence:CCGGGTTTGGGATCGAGATCTGGAACTCGAGTTCCAGATCTCGATCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174950
KGFLP1 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-468s1c1
Sequence:CCGGCGGTTGGGACAAGTACAGTAACTCGAGTTACTGTACTTGTCCCAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164145    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-925s1c1
Sequence:CCGGCCACTTTCTTCCTATGGCAATCTCGAGATTGCCATAGGAAGAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-752s1c1
Sequence:CCGGGCAAAGAAAGAATGCAATGAACTCGAGTTCATTGCATTCTTTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-447s1c1
Sequence:CCGGGTCTCAGCTTTCTCATCTGTACTCGAGTACAGATGAGAAAGCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-824s1c1
Sequence:CCGGGCAGCTAAATGGACACACAATCTCGAGATTGTGTGTCCATTTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-451s1c1
Sequence:CCGGCAGCTTTCTCATCTGTACGGTCTCGAGACCGTACAGATGAGAAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174950.2-1382s1c1
Sequence:CCGGGCTGGCAGGATTTGTCAGATACTCGAGTATCTGACAAATCCTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165198    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174950.2-208s1c1
Sequence:CCGGGTTTGGGATCGAGATCTGGAACTCGAGTTCCAGATCTCGATCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)