EMAIL THIS PAGE TO A FRIEND

KHDC1

KH homology domain containing 1

36 Gene Product Result for
Synonyms: C6orf148 NDG1 bA257K9.4
Species: Human KHDC1(80759)
UniProtKB ID: Q4VXA5, Q5JSQ7, Q8WTV2, Q96NQ5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030568 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070151 MISSION® esiRNA esiRNA human KHDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030568 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358127 predicted 450
2 SASI_Hs02_00358128 predicted 454
3 SASI_Hs01_00084004 predicted 433
4 SASI_Hs02_00358129 predicted 483
5 SASI_Hs02_00358130 predicted 431
6 SASI_Hs02_00358131 predicted 427
7 SASI_Hs02_00358132 predicted 484
8 SASI_Hs02_00358133 predicted 453
9 SASI_Hs02_00358134 predicted 436
10 SASI_Hs01_00084001 predicted 544
11 SASI_Hs01_00084000 predicted 1585
12 SASI_Hs01_00084002 predicted 591
13 SASI_Hs01_00084003 predicted 701
14 SASI_Hs01_00084005 predicted 1558
15 SASI_Hs01_00084006 predicted 560
16 SASI_Hs01_00084007 predicted 856
17 SASI_Hs01_00084008 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030568
KHDC1 MISSION shRNA Bacterial Glycerol Stock
KH homology domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-796s1c1
Sequence:CCGGCCAATGGTGTTCCACATGGAACTCGAGTTCCATGTGGAACACCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-837s1c1
Sequence:CCGGCTTCGGACTTGATGACACGTACTCGAGTACGTGTCATCAAGTCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1726s1c1
Sequence:CCGGCCTTTCCCTTACCAAGTGATTCTCGAGAATCACTTGGTAAGGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1767s1c1
Sequence:CCGGGAGTTCACTCTATTCGTAATTCTCGAGAATTACGAATAGAGTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1364s1c1
Sequence:CCGGCCAATGGTGTTTCACATGGAACTCGAGTTCCATGTGAAACACCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-692s1c1
Sequence:CCGGCAGGACTCCTATCATCATGCTCTCGAGAGCATGATGATAGGAGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-593s1c1
Sequence:CCGGGAGAGTTGGTTCACAGCTACACTCGAGTGTAGCTGTGAACCAACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-786s1c1
Sequence:CCGGCTTTCATTCTCCAATGGTGTTCTCGAGAACACCATTGGAGAATGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030568
KHDC1 MISSION shRNA shRNA Plasmid DNA
KH homology domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-796s1c1
Sequence:CCGGCCAATGGTGTTCCACATGGAACTCGAGTTCCATGTGGAACACCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-837s1c1
Sequence:CCGGCTTCGGACTTGATGACACGTACTCGAGTACGTGTCATCAAGTCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1726s1c1
Sequence:CCGGCCTTTCCCTTACCAAGTGATTCTCGAGAATCACTTGGTAAGGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1767s1c1
Sequence:CCGGGAGTTCACTCTATTCGTAATTCTCGAGAATTACGAATAGAGTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1364s1c1
Sequence:CCGGCCAATGGTGTTTCACATGGAACTCGAGTTCCATGTGAAACACCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-692s1c1
Sequence:CCGGCAGGACTCCTATCATCATGCTCTCGAGAGCATGATGATAGGAGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-593s1c1
Sequence:CCGGGAGAGTTGGTTCACAGCTACACTCGAGTGTAGCTGTGAACCAACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-786s1c1
Sequence:CCGGCTTTCATTCTCCAATGGTGTTCTCGAGAACACCATTGGAGAATGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030568
KHDC1 MISSION shRNA Lentiviral Transduction Particles
KH homology domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-796s1c1
Sequence:CCGGCCAATGGTGTTCCACATGGAACTCGAGTTCCATGTGGAACACCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-837s1c1
Sequence:CCGGCTTCGGACTTGATGACACGTACTCGAGTACGTGTCATCAAGTCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1726s1c1
Sequence:CCGGCCTTTCCCTTACCAAGTGATTCTCGAGAATCACTTGGTAAGGGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1767s1c1
Sequence:CCGGGAGTTCACTCTATTCGTAATTCTCGAGAATTACGAATAGAGTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030568.2-1364s1c1
Sequence:CCGGCCAATGGTGTTTCACATGGAACTCGAGTTCCATGTGAAACACCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-692s1c1
Sequence:CCGGCAGGACTCCTATCATCATGCTCTCGAGAGCATGATGATAGGAGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-593s1c1
Sequence:CCGGGAGAGTTGGTTCACAGCTACACTCGAGTGTAGCTGTGAACCAACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030568.2-786s1c1
Sequence:CCGGCTTTCATTCTCCAATGGTGTTCTCGAGAACACCATTGGAGAATGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)