EMAIL THIS PAGE TO A FRIEND

Khdc1b

30 Gene Product Result for
Gene ID:
Rat(689101) KH domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001113187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001113187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001113187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213781 MISSION® esiRNA targeting mouse Khdc1b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001069525 Rosetta Predictions rat pricing
NM_001113187 Rosetta Predictions mouse pricing
XM_355193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328362 predicted 205
2 SASI_Rn02_00328363 predicted 203
3 SASI_Rn02_00328364 predicted 212
4 SASI_Rn02_00328365 predicted 204
5 SASI_Rn02_00328366 predicted 19
6 SASI_Rn02_00328367 predicted 435
7 SASI_Rn02_00328368 predicted 41
8 SASI_Rn02_00328369 predicted 25
9 SASI_Rn02_00328370 predicted 37
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307173 predicted 632
2 SASI_Mm02_00307174 predicted 745
3 SASI_Mm02_00307175 predicted 657
4 SASI_Mm02_00307176 predicted 954
5 SASI_Mm02_00307177 predicted 754
6 SASI_Mm02_00307178 predicted 785
7 SASI_Mm02_00307179 predicted 977
8 SASI_Mm02_00307180 predicted 1044
9 SASI_Mm02_00307181 predicted 536
10 SASI_Mm02_00307182 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221898 predicted 636
2 SASI_Mm01_00221899 predicted 758
3 SASI_Mm01_00221900 predicted 659
4 SASI_Mm01_00221901 predicted 951
5 SASI_Mm01_00221902 predicted 760
6 SASI_Mm01_00221903 predicted 793
7 SASI_Mm01_00221904 predicted 975
8 SASI_Mm01_00221905 predicted 1047
9 SASI_Mm01_00221906 predicted 542
10 SASI_Mm01_00221907 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001113187
Khdc1b MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000262279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-749s21c1
Sequence:CCGGGGTTCCCTGATTGAGTGATTGCTCGAGCAATCACTCAATCAGGGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113187.1-1020s21c1
Sequence:CCGGATTCTGGCAAAGGTATCTAATCTCGAGATTAGATACCTTTGCCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-637s21c1
Sequence:CCGGAGTAAGAACACTCTCGATAAACTCGAGTTTATCGAGAGTGTTCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-666s21c1
Sequence:CCGGCAAGTTGATGCTACTCCATATCTCGAGATATGGAGTAGCATCAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001113187
Khdc1b MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000262279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-749s21c1
Sequence:CCGGGGTTCCCTGATTGAGTGATTGCTCGAGCAATCACTCAATCAGGGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113187.1-1020s21c1
Sequence:CCGGATTCTGGCAAAGGTATCTAATCTCGAGATTAGATACCTTTGCCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-637s21c1
Sequence:CCGGAGTAAGAACACTCTCGATAAACTCGAGTTTATCGAGAGTGTTCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-666s21c1
Sequence:CCGGCAAGTTGATGCTACTCCATATCTCGAGATATGGAGTAGCATCAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001113187
Khdc1b MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000262279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-749s21c1
Sequence:CCGGGGTTCCCTGATTGAGTGATTGCTCGAGCAATCACTCAATCAGGGAACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001113187.1-1020s21c1
Sequence:CCGGATTCTGGCAAAGGTATCTAATCTCGAGATTAGATACCTTTGCCAGAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000262281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-637s21c1
Sequence:CCGGAGTAAGAACACTCTCGATAAACTCGAGTTTATCGAGAGTGTTCTTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000282163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001113187.1-666s21c1
Sequence:CCGGCAAGTTGATGCTACTCCATATCTCGAGATATGGAGTAGCATCAACTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???