EMAIL THIS PAGE TO A FRIEND

Khdc1c

11 Gene Product Result for
Gene ID:
Rat(689090) KH domain containing 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU201721 MISSION® esiRNA targeting mouse Khdc1c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115705 predicted 574
2 SASI_Mm01_00115706 predicted 581
3 SASI_Mm01_00115707 predicted 575
4 SASI_Mm01_00115708 predicted 605
5 SASI_Mm01_00115709 predicted 593
6 SASI_Mm01_00115710 predicted 734
7 SASI_Mm01_00115711 predicted 628
8 SASI_Mm01_00115712 predicted 684
9 SASI_Mm01_00115713 predicted 642
10 SASI_Mm01_00115714 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033904
Khdc1c MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-702s21c1
Sequence:CCGGCACAATGAATGATACGACTTTCTCGAGAAAGTCGTATCATTCATTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-390s1c1
Sequence:CCGGGTTTGACATGGAAGAGGACAACTCGAGTTGTCCTCTTCCATGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-554s21c1
Sequence:CCGGGGGTGATGGACATGATCAGAACTCGAGTTCTGATCATGTCCATCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-423s21c1
Sequence:CCGGATTTGGCCCTCATGATGAATACTCGAGTATTCATCATGAGGGCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-675s21c1
Sequence:CCGGGGAATCAGGGAGCAGTCTTTGCTCGAGCAAAGACTGCTCCCTGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-487s1c1
Sequence:CCGGGAAAGATGGTTCACACCCACACTCGAGTGTGGGTGTGAACCATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-582s1c1
Sequence:CCGGGAGTAAGAACAATTTGGATCACTCGAGTGATCCAAATTGTTCTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-622s21c1
Sequence:CCGGCTACTGCAGATCCGGGATCATCTCGAGATGATCCCGGATCTGCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033904
Khdc1c MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-702s21c1
Sequence:CCGGCACAATGAATGATACGACTTTCTCGAGAAAGTCGTATCATTCATTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-390s1c1
Sequence:CCGGGTTTGACATGGAAGAGGACAACTCGAGTTGTCCTCTTCCATGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-554s21c1
Sequence:CCGGGGGTGATGGACATGATCAGAACTCGAGTTCTGATCATGTCCATCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-423s21c1
Sequence:CCGGATTTGGCCCTCATGATGAATACTCGAGTATTCATCATGAGGGCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-675s21c1
Sequence:CCGGGGAATCAGGGAGCAGTCTTTGCTCGAGCAAAGACTGCTCCCTGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-487s1c1
Sequence:CCGGGAAAGATGGTTCACACCCACACTCGAGTGTGGGTGTGAACCATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-582s1c1
Sequence:CCGGGAGTAAGAACAATTTGGATCACTCGAGTGATCCAAATTGTTCTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-622s21c1
Sequence:CCGGCTACTGCAGATCCGGGATCATCTCGAGATGATCCCGGATCTGCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033904
Khdc1c MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-702s21c1
Sequence:CCGGCACAATGAATGATACGACTTTCTCGAGAAAGTCGTATCATTCATTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-390s1c1
Sequence:CCGGGTTTGACATGGAAGAGGACAACTCGAGTTGTCCTCTTCCATGTCAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000265585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-554s21c1
Sequence:CCGGGGGTGATGGACATGATCAGAACTCGAGTTCTGATCATGTCCATCACCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000254612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-423s21c1
Sequence:CCGGATTTGGCCCTCATGATGAATACTCGAGTATTCATCATGAGGGCCAAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000254613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-675s21c1
Sequence:CCGGGGAATCAGGGAGCAGTCTTTGCTCGAGCAAAGACTGCTCCCTGATTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-487s1c1
Sequence:CCGGGAAAGATGGTTCACACCCACACTCGAGTGTGGGTGTGAACCATCTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033904.1-582s1c1
Sequence:CCGGGAGTAAGAACAATTTGGATCACTCGAGTGATCCAAATTGTTCTTACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000254614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033904.1-622s21c1
Sequence:CCGGCTACTGCAGATCCGGGATCATCTCGAGATGATCCCGGATCTGCAGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???