EMAIL THIS PAGE TO A FRIEND

KHDC1L

KH homology domain containing 1-like

12 Gene Product Result for
UniProtKB ID: Q5JSQ8, E1P535
Gene ID:
cow(100295140) KH homology domain containing 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001126063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126063 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126063 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328117 predicted 935
2 SASI_Hs02_00328118 predicted 1412
3 SASI_Hs02_00328119 predicted 1098
4 SASI_Hs02_00328120 predicted 1112
5 SASI_Hs02_00328121 predicted 1579
6 SASI_Hs02_00328122 predicted 879
7 SASI_Hs02_00328123 predicted 1323
8 SASI_Hs02_00328124 predicted 1377
9 SASI_Hs02_00328125 predicted 857
10 SASI_Hs02_00328126 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126063
KHDC1L MISSION shRNA Bacterial Glycerol Stock
KH homology domain containing 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-284s21c1
Sequence:CCGGGCTGCTGCTCATGTTCCATTGCTCGAGCAATGGAACATGAGCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-257s21c1
Sequence:CCGGAGTCGGACCACCAATGGCAAACTCGAGTTTGCCATTGGTGGTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-103s21c1
Sequence:CCGGTTCATTCTCCAATGGTGTTCCCTCGAGGGAACACCATTGGAGAATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-143s21c1
Sequence:CCGGGGAGCTCATCTTCGGACTTGACTCGAGTCAAGTCCGAAGATGAGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-335s21c1
Sequence:CCGGTCGAGGTCTGAAGATGCTAGACTCGAGTCTAGCATCTTCAGACCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126063
KHDC1L MISSION shRNA shRNA Plasmid DNA
KH homology domain containing 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-284s21c1
Sequence:CCGGGCTGCTGCTCATGTTCCATTGCTCGAGCAATGGAACATGAGCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-257s21c1
Sequence:CCGGAGTCGGACCACCAATGGCAAACTCGAGTTTGCCATTGGTGGTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-103s21c1
Sequence:CCGGTTCATTCTCCAATGGTGTTCCCTCGAGGGAACACCATTGGAGAATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-143s21c1
Sequence:CCGGGGAGCTCATCTTCGGACTTGACTCGAGTCAAGTCCGAAGATGAGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-335s21c1
Sequence:CCGGTCGAGGTCTGAAGATGCTAGACTCGAGTCTAGCATCTTCAGACCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126063
KHDC1L MISSION shRNA Lentiviral Transduction Particles
KH homology domain containing 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-284s21c1
Sequence:CCGGGCTGCTGCTCATGTTCCATTGCTCGAGCAATGGAACATGAGCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-257s21c1
Sequence:CCGGAGTCGGACCACCAATGGCAAACTCGAGTTTGCCATTGGTGGTCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-103s21c1
Sequence:CCGGTTCATTCTCCAATGGTGTTCCCTCGAGGGAACACCATTGGAGAATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-143s21c1
Sequence:CCGGGGAGCTCATCTTCGGACTTGACTCGAGTCAAGTCCGAAGATGAGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126063.2-335s21c1
Sequence:CCGGTCGAGGTCTGAAGATGCTAGACTCGAGTCTAGCATCTTCAGACCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)