EMAIL THIS PAGE TO A FRIEND

KHDC3L

KH domain containing 3-like, subcortical maternal complex member

33 Gene Product Result for
Synonyms: C6orf221 ECAT1 HYDM2
UniProtKB ID: Q587J8, B2RNW7
Gene ID:
Human(154288) Summary: The protein encoded by this gene belongs to the KHDC1 family, members of which contain an atypical KH domain that may not bind RNA like canonical KH domains. This gene is specifically expressed in the oocytes, and recent studies suggest that it may function as a regulator of genomic imprinting in the oocyte. Mutations in this gene are associated with recurrent biparental complete hydatidiform mole. [provided by RefSeq, Dec 2011]
sheep(101123050) KH domain containing 3-like, subcortical maternal complex member
domestic cat(101097319) KH domain containing 3-like, subcortical maternal complex member
cow(616454) KH domain containing 3-like, subcortical maternal complex member
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017361 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141931 MISSION® esiRNA esiRNA human C6orf221 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017361 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055072 predicted 246
2 SASI_Hs01_00055073 predicted 339
3 SASI_Hs01_00055075 predicted 541
4 SASI_Hs01_00055076 predicted 251
5 SASI_Hs02_00306695 predicted 594
6 SASI_Hs01_00055077 predicted 245
7 SASI_Hs02_00306696 predicted 414
8 SASI_Hs01_00055078 predicted 555
9 SASI_Hs02_00306697 predicted 259
10 SASI_Hs01_00055079 predicted 290
11 SASI_Hs01_00055074 predicted 278
12 SASI_Hs01_00055080 predicted 289
13 SASI_Hs01_00055081 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017361
KHDC3L MISSION shRNA Bacterial Glycerol Stock
KH domain containing 3-like, subcortical maternal complex member
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-279s21c1
Sequence:CCGGGTGAATCGATTGGACCCTAACCTCGAGGTTAGGGTCCAATCGATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-303s21c1
Sequence:CCGGGAGGCTGAGATCTTGGTATTTCTCGAGAAATACCAAGATCTCAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017361.2-746s21c1
Sequence:CCGGTAAAGTGAAAGCCCGTATTTCCTCGAGGAAATACGGGCTTTCACTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-256s21c1
Sequence:CCGGGTATGTCCCAAATCTTGATTCCTCGAGGAATCAAGATTTGGGACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-168s1c1
Sequence:CCGGCTGAAGAATCCGAAGGTAGTTCTCGAGAACTACCTTCGGATTCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-356s1c1
Sequence:CCGGGATGATCATGAACCTGGCTGACTCGAGTCAGCCAGGTTCATGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-338s1c1
Sequence:CCGGCCAGGAGGACACAATCAAGATCTCGAGATCTTGATTGTGTCCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017361.1-832s1c1
Sequence:CCGGGCAAACACAAACTTGAGTTCTCTCGAGAGAACTCAAGTTTGTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-458s1c1
Sequence:CCGGGTCTTCAATAGAAGTCCGGGACTCGAGTCCCGGACTTCTATTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017361
KHDC3L MISSION shRNA shRNA Plasmid DNA
KH domain containing 3-like, subcortical maternal complex member
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-279s21c1
Sequence:CCGGGTGAATCGATTGGACCCTAACCTCGAGGTTAGGGTCCAATCGATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-303s21c1
Sequence:CCGGGAGGCTGAGATCTTGGTATTTCTCGAGAAATACCAAGATCTCAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017361.2-746s21c1
Sequence:CCGGTAAAGTGAAAGCCCGTATTTCCTCGAGGAAATACGGGCTTTCACTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-256s21c1
Sequence:CCGGGTATGTCCCAAATCTTGATTCCTCGAGGAATCAAGATTTGGGACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-168s1c1
Sequence:CCGGCTGAAGAATCCGAAGGTAGTTCTCGAGAACTACCTTCGGATTCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-356s1c1
Sequence:CCGGGATGATCATGAACCTGGCTGACTCGAGTCAGCCAGGTTCATGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-338s1c1
Sequence:CCGGCCAGGAGGACACAATCAAGATCTCGAGATCTTGATTGTGTCCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017361.1-832s1c1
Sequence:CCGGGCAAACACAAACTTGAGTTCTCTCGAGAGAACTCAAGTTTGTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-458s1c1
Sequence:CCGGGTCTTCAATAGAAGTCCGGGACTCGAGTCCCGGACTTCTATTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017361
KHDC3L MISSION shRNA Lentiviral Transduction Particles
KH domain containing 3-like, subcortical maternal complex member
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-279s21c1
Sequence:CCGGGTGAATCGATTGGACCCTAACCTCGAGGTTAGGGTCCAATCGATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-303s21c1
Sequence:CCGGGAGGCTGAGATCTTGGTATTTCTCGAGAAATACCAAGATCTCAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017361.2-746s21c1
Sequence:CCGGTAAAGTGAAAGCCCGTATTTCCTCGAGGAAATACGGGCTTTCACTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017361.2-256s21c1
Sequence:CCGGGTATGTCCCAAATCTTGATTCCTCGAGGAATCAAGATTTGGGACATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-168s1c1
Sequence:CCGGCTGAAGAATCCGAAGGTAGTTCTCGAGAACTACCTTCGGATTCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-356s1c1
Sequence:CCGGGATGATCATGAACCTGGCTGACTCGAGTCAGCCAGGTTCATGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-338s1c1
Sequence:CCGGCCAGGAGGACACAATCAAGATCTCGAGATCTTGATTGTGTCCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017361.1-832s1c1
Sequence:CCGGGCAAACACAAACTTGAGTTCTCTCGAGAGAACTCAAGTTTGTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017361.1-458s1c1
Sequence:CCGGGTCTTCAATAGAAGTCCGGGACTCGAGTCCCGGACTTCTATTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)