EMAIL THIS PAGE TO A FRIEND

KHDRBS1

KH domain containing, RNA binding, signal transduction associated 1

136 Gene Product Result for
Synonyms: Sam68 p62 p68
UniProtKB ID: Q07666, D3DPP3, Q6PJX7, Q8NB97, Q99760
Gene ID:
Human(10657) Summary: This gene encodes a member of the K homology domain-containing, RNA-binding, signal transduction-associated protein family. The encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(20218) KH domain containing, RNA binding, signal transduction associated 1
Rat(117268) KH domain containing, RNA binding, signal transduction associated 1
chicken(374071) KH domain containing, RNA binding, signal transduction associated 1
domestic cat(101080467) KH domain containing, RNA binding, signal transduction associated 1
dog(487316) KH domain containing, RNA binding, signal transduction associated 1
cow(538775) KH domain containing, RNA binding, signal transduction associated 1
sheep(101117825) KH domain containing, RNA binding, signal transduction associated 1
domestic guinea pig(100725478) KH domain containing, RNA binding, signal transduction associated 1
naked mole-rat(101708086) KH domain containing, RNA binding, signal transduction associated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407036 Anti-KHDRBS1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV40665 Anti-KHDRBS1 antibody produced in rabbit affinity isolated antibody horse, mouse, guinea pig, rat, human, rabbit, bovine
western blot pricing
AV37130 Anti-KHDRBS1 antibody produced in rabbit IgG fraction of antiserum human, rabbit, rat, bovine, mouse, guinea pig
western blot pricing
HPA051280 Anti-KHDRBS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA056813 Anti-KHDRBS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104552 Anti-KHDRBS1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rat, bovine, rabbit, human
western blot pricing
S9575 Anti-Sam68 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution immunofluorescence, immunoprecipitation (IP), western blot pricing
S9450 Anti-Sam68 (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution western blot pricing
WH0010657M3 Monoclonal Anti-KHDRBS1 antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006559 Rosetta Predictions human pricing
NM_130405 Rosetta Predictions rat pricing
NM_011317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219776 predicted 822
2 SASI_Hs01_00219777 predicted 1467
3 SASI_Hs01_00219778 predicted 1461
4 SASI_Hs01_00219780 predicted 823
5 SASI_Hs01_00219781 predicted 1191
6 SASI_Hs01_00219782 predicted 1455
7 SASI_Hs01_00219784 predicted 1471
8 SASI_Hs01_00219785 predicted 567
9 SASI_Hs02_00341830 predicted 671
10 SASI_Hs02_00341831 predicted 567
11 SASI_Hs01_00219779 predicted 1498
12 SASI_Hs01_00219783 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111991 predicted 805
2 SASI_Rn01_00111992 predicted 1442
3 SASI_Rn01_00111993 predicted 1290
4 SASI_Rn01_00111994 predicted 881
5 SASI_Rn01_00111995 predicted 1433
6 SASI_Rn01_00111996 predicted 475
7 SASI_Rn01_00111997 predicted 1167
8 SASI_Rn01_00111998 predicted 1167
9 SASI_Rn01_00111999 predicted 1469
10 SASI_Rn01_00112000 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163575 predicted 842
2 SASI_Mm02_00320406 predicted 598
3 SASI_Mm01_00163576 predicted 604
4 SASI_Mm01_00163577 predicted 918
5 SASI_Mm01_00163578 predicted 1212
6 SASI_Mm01_00163579 predicted 1425
7 SASI_Mm01_00163580 predicted 890
8 SASI_Mm01_00163581 predicted 1469
9 SASI_Mm01_00163582 predicted 510
10 SASI_Mm01_00163583 predicted 768
11 SASI_Mm01_00163584 predicted 1414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006559
KHDRBS1 MISSION shRNA Bacterial Glycerol Stock
KH domain containing, RNA binding, signal transduction associated 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006559.1-1245s21c1
Sequence:CCGGACGAAGGCTACGAAGGCTATTCTCGAGAATAGCCTTCGTAGCCTTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006559.1-695s21c1
Sequence:CCGGGTATTGGGAAAGGGCTCAATGCTCGAGCATTGAGCCCTTTCCCAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006559.1-1519s21c1
Sequence:CCGGACCCACAACAGACAAGTAATTCTCGAGAATTACTTGTCTGTTGTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006559.x-2443s1c1
Sequence:CCGGGTTCCCAAGTTAGTCAAGTATCTCGAGATACTTGACTAACTTGGGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-641s1c1
Sequence:CCGGCCACAAGGGAATACAATCAAACTCGAGTTTGATTGTATTCCCTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-527s1c1
Sequence:CCGGGATGAGGAGAATTACTTGGATCTCGAGATCCAAGTAATTCTCCTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-481s1c1
Sequence:CCGGGACGGCAGAAATTGAGAAGATCTCGAGATCTTCTCAATTTCTGCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-872s1c1
Sequence:CCGGGTACCGGATATGATGGATGATCTCGAGATCATCCATCATATCCGGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006559
KHDRBS1 MISSION shRNA shRNA Plasmid DNA
KH domain containing, RNA binding, signal transduction associated 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006559.1-1245s21c1
Sequence:CCGGACGAAGGCTACGAAGGCTATTCTCGAGAATAGCCTTCGTAGCCTTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006559.1-695s21c1
Sequence:CCGGGTATTGGGAAAGGGCTCAATGCTCGAGCATTGAGCCCTTTCCCAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006559.1-1519s21c1
Sequence:CCGGACCCACAACAGACAAGTAATTCTCGAGAATTACTTGTCTGTTGTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006559.x-2443s1c1
Sequence:CCGGGTTCCCAAGTTAGTCAAGTATCTCGAGATACTTGACTAACTTGGGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-641s1c1
Sequence:CCGGCCACAAGGGAATACAATCAAACTCGAGTTTGATTGTATTCCCTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-527s1c1
Sequence:CCGGGATGAGGAGAATTACTTGGATCTCGAGATCCAAGTAATTCTCCTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-481s1c1
Sequence:CCGGGACGGCAGAAATTGAGAAGATCTCGAGATCTTCTCAATTTCTGCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-872s1c1
Sequence:CCGGGTACCGGATATGATGGATGATCTCGAGATCATCCATCATATCCGGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006559
KHDRBS1 MISSION shRNA Lentiviral Transduction Particles
KH domain containing, RNA binding, signal transduction associated 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006559.1-1245s21c1
Sequence:CCGGACGAAGGCTACGAAGGCTATTCTCGAGAATAGCCTTCGTAGCCTTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006559.1-695s21c1
Sequence:CCGGGTATTGGGAAAGGGCTCAATGCTCGAGCATTGAGCCCTTTCCCAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006559.1-1519s21c1
Sequence:CCGGACCCACAACAGACAAGTAATTCTCGAGAATTACTTGTCTGTTGTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006559.x-2443s1c1
Sequence:CCGGGTTCCCAAGTTAGTCAAGTATCTCGAGATACTTGACTAACTTGGGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-641s1c1
Sequence:CCGGCCACAAGGGAATACAATCAAACTCGAGTTTGATTGTATTCCCTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-527s1c1
Sequence:CCGGGATGAGGAGAATTACTTGGATCTCGAGATCCAAGTAATTCTCCTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-481s1c1
Sequence:CCGGGACGGCAGAAATTGAGAAGATCTCGAGATCTTCTCAATTTCTGCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006559.x-872s1c1
Sequence:CCGGGTACCGGATATGATGGATGATCTCGAGATCATCCATCATATCCGGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011317
VALIDATED
KHDRBS1 MISSION shRNA Bacterial Glycerol Stock
KH domain containing, RNA binding, signal transduction associated 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-1209s21c1
Sequence:CCGGCCAGAAACATACGAAGATTATCTCGAGATAATCTTCGTATGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-803s21c1
Sequence:CCGGGCATGTCTTCATTGAAGTCTTCTCGAGAAGACTTCAATGAAGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-545s21c1
Sequence:CCGGCGAGGAGAATTATTTGGATTTCTCGAGAAATCCAAATAATTCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011317.3-1596s21c1
Sequence:CCGGCCTCCATTCTTAACTCTGCATCTCGAGATGCAGAGTTAAGAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-1334s21c1
Sequence:CCGGCCAAGATTCTTACGAAGCCTACTCGAGTAGGCTTCGTAAGAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011317.2-1585s1c1
Sequence:CCGGCCTCCATTCTTAACTCTGCATCTCGAGATGCAGAGTTAAGAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011317.2-792s1c1
Sequence:CCGGGCATGTCTTCATTGAAGTCTTCTCGAGAAGACTTCAATGAAGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011317.2-534s1c1
Sequence:CCGGCGAGGAGAATTATTTGGATTTCTCGAGAAATCCAAATAATTCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011317.2-1323s1c1
Sequence:CCGGCCAAGATTCTTACGAAGCCTACTCGAGTAGGCTTCGTAAGAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011317.2-1198s1c1
Sequence:CCGGCCAGAAACATACGAAGATTATCTCGAGATAATCTTCGTATGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011317
VALIDATED
KHDRBS1 MISSION shRNA shRNA Plasmid DNA
KH domain containing, RNA binding, signal transduction associated 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-1209s21c1
Sequence:CCGGCCAGAAACATACGAAGATTATCTCGAGATAATCTTCGTATGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-803s21c1
Sequence:CCGGGCATGTCTTCATTGAAGTCTTCTCGAGAAGACTTCAATGAAGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-545s21c1
Sequence:CCGGCGAGGAGAATTATTTGGATTTCTCGAGAAATCCAAATAATTCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011317.3-1596s21c1
Sequence:CCGGCCTCCATTCTTAACTCTGCATCTCGAGATGCAGAGTTAAGAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-1334s21c1
Sequence:CCGGCCAAGATTCTTACGAAGCCTACTCGAGTAGGCTTCGTAAGAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011317.2-1585s1c1
Sequence:CCGGCCTCCATTCTTAACTCTGCATCTCGAGATGCAGAGTTAAGAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011317.2-792s1c1
Sequence:CCGGGCATGTCTTCATTGAAGTCTTCTCGAGAAGACTTCAATGAAGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011317.2-534s1c1
Sequence:CCGGCGAGGAGAATTATTTGGATTTCTCGAGAAATCCAAATAATTCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011317.2-1323s1c1
Sequence:CCGGCCAAGATTCTTACGAAGCCTACTCGAGTAGGCTTCGTAAGAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011317.2-1198s1c1
Sequence:CCGGCCAGAAACATACGAAGATTATCTCGAGATAATCTTCGTATGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011317
VALIDATED
KHDRBS1 MISSION shRNA Lentiviral Transduction Particles
KH domain containing, RNA binding, signal transduction associated 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-1209s21c1
Sequence:CCGGCCAGAAACATACGAAGATTATCTCGAGATAATCTTCGTATGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-803s21c1
Sequence:CCGGGCATGTCTTCATTGAAGTCTTCTCGAGAAGACTTCAATGAAGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-545s21c1
Sequence:CCGGCGAGGAGAATTATTTGGATTTCTCGAGAAATCCAAATAATTCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011317.3-1596s21c1
Sequence:CCGGCCTCCATTCTTAACTCTGCATCTCGAGATGCAGAGTTAAGAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011317.3-1334s21c1
Sequence:CCGGCCAAGATTCTTACGAAGCCTACTCGAGTAGGCTTCGTAAGAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011317.2-1585s1c1
Sequence:CCGGCCTCCATTCTTAACTCTGCATCTCGAGATGCAGAGTTAAGAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011317.2-792s1c1
Sequence:CCGGGCATGTCTTCATTGAAGTCTTCTCGAGAAGACTTCAATGAAGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011317.2-534s1c1
Sequence:CCGGCGAGGAGAATTATTTGGATTTCTCGAGAAATCCAAATAATTCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011317.2-1323s1c1
Sequence:CCGGCCAAGATTCTTACGAAGCCTACTCGAGTAGGCTTCGTAAGAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011317.2-1198s1c1
Sequence:CCGGCCAGAAACATACGAAGATTATCTCGAGATAATCTTCGTATGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)