EMAIL THIS PAGE TO A FRIEND

KHDRBS2

KH domain containing, RNA binding, signal transduction associated 2

95 Gene Product Result for
Synonyms: SLM-1 SLM1 bA535F17.1
UniProtKB ID: Q5VWX1, A8K7M8, Q8N4I4, Q8TCZ4
Gene ID:
Mouse(170771) KH domain containing, RNA binding, signal transduction associated 2
Rat(170843) KH domain containing, RNA binding, signal transduction associated 2
Zebrafish(768147) KH domain containing, RNA binding, signal transduction associated 2
cow(789972) KH domain containing, RNA binding, signal transduction associated 2
Horse(100056966) KH domain containing, RNA binding, signal transduction associated 2
dog(481859) KH domain containing, RNA binding, signal transduction associated 2
chicken(428643) KH domain containing, RNA binding, signal transduction associated 2
naked mole-rat(101721234) KH domain containing, RNA binding, signal transduction associated 2
sheep(101105784) KH domain containing, RNA binding, signal transduction associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152688 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118411 MISSION® esiRNA esiRNA human KHDRBS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152688 Rosetta Predictions human pricing
NM_133318 Rosetta Predictions rat pricing
NM_133235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066567 predicted 453
2 SASI_Hs01_00066568 predicted 653
3 SASI_Hs01_00066569 predicted 1065
4 SASI_Hs01_00066570 predicted 835
5 SASI_Hs01_00066571 predicted 784
6 SASI_Hs01_00066572 predicted 1071
7 SASI_Hs01_00066573 predicted 1125
8 SASI_Hs01_00066574 predicted 705
9 SASI_Hs01_00066575 predicted 838
10 SASI_Hs01_00066576 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113281 predicted 1045
2 SASI_Rn01_00113282 predicted 712
3 SASI_Rn01_00113283 predicted 1050
4 SASI_Rn02_00267627 predicted 670
5 SASI_Rn01_00113284 predicted 532
6 SASI_Rn01_00113286 predicted 539
7 SASI_Rn01_00113287 predicted 377
8 SASI_Rn01_00113288 predicted 992
9 SASI_Rn01_00113289 predicted 942
10 SASI_Rn01_00113290 predicted 654
11 SASI_Rn01_00113285 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161164 predicted 627
2 SASI_Mm01_00161165 predicted 280
3 SASI_Mm01_00161166 predicted 958
4 SASI_Mm01_00161167 predicted 280
5 SASI_Mm01_00161168 predicted 411
6 SASI_Mm01_00161169 predicted 946
7 SASI_Mm01_00161170 predicted 689
8 SASI_Mm01_00161171 predicted 614
9 SASI_Mm02_00338472 predicted 1014
10 SASI_Mm02_00338473 predicted 893
11 SASI_Mm01_00161162 predicted 677
12 SASI_Mm01_00161163 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133235
KHDRBS2 MISSION shRNA Bacterial Glycerol Stock
KH domain containing, RNA binding, signal transduction associated 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-289s1c1
Sequence:CCGGGCTCTCTGAAAGAGTATTGATCTCGAGATCAATACTCTTTCAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-628s1c1
Sequence:CCGGCCGGGAGTTGTCTTACTTGAACTCGAGTTCAAGTAAGACAACTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-194s1c1
Sequence:CCGGCTGGCGGAAGAAATTGAGAAACTCGAGTTTCTCAATTTCTTCCGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133235.2-1182s1c1
Sequence:CCGGCCTCCTCAAAGACAATTCATACTCGAGTATGAATTGTCTTTGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-960s1c1
Sequence:CCGGAGACCTATGAGGCTTATGATACTCGAGTATCATAAGCCTCATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133235
KHDRBS2 MISSION shRNA shRNA Plasmid DNA
KH domain containing, RNA binding, signal transduction associated 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-289s1c1
Sequence:CCGGGCTCTCTGAAAGAGTATTGATCTCGAGATCAATACTCTTTCAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-628s1c1
Sequence:CCGGCCGGGAGTTGTCTTACTTGAACTCGAGTTCAAGTAAGACAACTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-194s1c1
Sequence:CCGGCTGGCGGAAGAAATTGAGAAACTCGAGTTTCTCAATTTCTTCCGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133235.2-1182s1c1
Sequence:CCGGCCTCCTCAAAGACAATTCATACTCGAGTATGAATTGTCTTTGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-960s1c1
Sequence:CCGGAGACCTATGAGGCTTATGATACTCGAGTATCATAAGCCTCATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133235
KHDRBS2 MISSION shRNA Lentiviral Transduction Particles
KH domain containing, RNA binding, signal transduction associated 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-289s1c1
Sequence:CCGGGCTCTCTGAAAGAGTATTGATCTCGAGATCAATACTCTTTCAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-628s1c1
Sequence:CCGGCCGGGAGTTGTCTTACTTGAACTCGAGTTCAAGTAAGACAACTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-194s1c1
Sequence:CCGGCTGGCGGAAGAAATTGAGAAACTCGAGTTTCTCAATTTCTTCCGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133235.2-1182s1c1
Sequence:CCGGCCTCCTCAAAGACAATTCATACTCGAGTATGAATTGTCTTTGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133235.2-960s1c1
Sequence:CCGGAGACCTATGAGGCTTATGATACTCGAGTATCATAAGCCTCATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152688
KHDRBS2 MISSION shRNA Bacterial Glycerol Stock
KH domain containing, RNA binding, signal transduction associated 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-456s1c1
Sequence:CCGGGCTCTCAGAAAGAGTACTGATCTCGAGATCAGTACTCTTTCTGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-1063s1c1
Sequence:CCGGCCAGCCCATGAAGCTTATGAACTCGAGTTCATAAGCTTCATGGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-1126s1c1
Sequence:CCGGCAGACCTATGAGACTTATGATCTCGAGATCATAAGTCTCATAGGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-760s1c1
Sequence:CCGGCCTGACTACAATGATGAAATTCTCGAGAATTTCATCATTGTAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-781s1c1
Sequence:CCGGCGTCAGGAACAACTACGTGAACTCGAGTTCACGTAGTTGTTCCTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152688.2-1458s21c1
Sequence:CCGGTGTACTGTTGGCGTGACATTGCTCGAGCAATGTCACGCCAACAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152688.2-628s21c1
Sequence:CCGGGAGTGATGAGCTTCATGTATTCTCGAGAATACATGAAGCTCATCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152688.2-1517s21c1
Sequence:CCGGTTAGCAAGCATAGTCTATAAACTCGAGTTTATAGACTATGCTTGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152688.2-577s21c1
Sequence:CCGGAGCTAAGGAAGAAGAACTAAGCTCGAGCTTAGTTCTTCTTCCTTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152688
KHDRBS2 MISSION shRNA shRNA Plasmid DNA
KH domain containing, RNA binding, signal transduction associated 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-456s1c1
Sequence:CCGGGCTCTCAGAAAGAGTACTGATCTCGAGATCAGTACTCTTTCTGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-1063s1c1
Sequence:CCGGCCAGCCCATGAAGCTTATGAACTCGAGTTCATAAGCTTCATGGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-1126s1c1
Sequence:CCGGCAGACCTATGAGACTTATGATCTCGAGATCATAAGTCTCATAGGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-760s1c1
Sequence:CCGGCCTGACTACAATGATGAAATTCTCGAGAATTTCATCATTGTAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-781s1c1
Sequence:CCGGCGTCAGGAACAACTACGTGAACTCGAGTTCACGTAGTTGTTCCTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152688.2-1458s21c1
Sequence:CCGGTGTACTGTTGGCGTGACATTGCTCGAGCAATGTCACGCCAACAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152688.2-628s21c1
Sequence:CCGGGAGTGATGAGCTTCATGTATTCTCGAGAATACATGAAGCTCATCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152688.2-1517s21c1
Sequence:CCGGTTAGCAAGCATAGTCTATAAACTCGAGTTTATAGACTATGCTTGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152688.2-577s21c1
Sequence:CCGGAGCTAAGGAAGAAGAACTAAGCTCGAGCTTAGTTCTTCTTCCTTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152688
KHDRBS2 MISSION shRNA Lentiviral Transduction Particles
KH domain containing, RNA binding, signal transduction associated 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-456s1c1
Sequence:CCGGGCTCTCAGAAAGAGTACTGATCTCGAGATCAGTACTCTTTCTGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-1063s1c1
Sequence:CCGGCCAGCCCATGAAGCTTATGAACTCGAGTTCATAAGCTTCATGGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-1126s1c1
Sequence:CCGGCAGACCTATGAGACTTATGATCTCGAGATCATAAGTCTCATAGGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-760s1c1
Sequence:CCGGCCTGACTACAATGATGAAATTCTCGAGAATTTCATCATTGTAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152688.1-781s1c1
Sequence:CCGGCGTCAGGAACAACTACGTGAACTCGAGTTCACGTAGTTGTTCCTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152688.2-1458s21c1
Sequence:CCGGTGTACTGTTGGCGTGACATTGCTCGAGCAATGTCACGCCAACAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152688.2-628s21c1
Sequence:CCGGGAGTGATGAGCTTCATGTATTCTCGAGAATACATGAAGCTCATCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152688.2-1517s21c1
Sequence:CCGGTTAGCAAGCATAGTCTATAAACTCGAGTTTATAGACTATGCTTGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152688.2-577s21c1
Sequence:CCGGAGCTAAGGAAGAAGAACTAAGCTCGAGCTTAGTTCTTCTTCCTTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)