EMAIL THIS PAGE TO A FRIEND

KHDRBS3

KH domain containing, RNA binding, signal transduction associated 3

101 Gene Product Result for
Synonyms: Etle SALP SLM-2 SLM2 T-STAR TSTAR etoile
UniProtKB ID: O75525, Q6NUL8, Q9UPA8
Gene ID:
Mouse(13992) KH domain containing, RNA binding, signal transduction associated 3
Rat(64015) KH domain containing, RNA binding, signal transduction associated 3
sheep(101119650) KH domain containing, RNA binding, signal transduction associated 3
domestic guinea pig(100720695) KH domain containing, RNA binding, signal transduction associated 3
naked mole-rat(101718606) KH domain containing, RNA binding, signal transduction associated 3
Zebrafish(101867535) KH domain containing, RNA binding, signal transduction associated 3
chicken(420317) KH domain containing, RNA binding, signal transduction associated 3
dog(475106) KH domain containing, RNA binding, signal transduction associated 3
cow(615095) KH domain containing, RNA binding, signal transduction associated 3
Horse(100058116) KH domain containing, RNA binding, signal transduction associated 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077961 MISSION® esiRNA esiRNA human KHDRBS3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006558 Rosetta Predictions human pricing
NM_022249 Rosetta Predictions rat pricing
NM_010158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091585 predicted 1168
2 SASI_Hs01_00091586 predicted 747
3 SASI_Hs01_00091587 predicted 743
4 SASI_Hs01_00091588 predicted 900
5 SASI_Hs01_00091590 predicted 1272
6 SASI_Hs02_00341829 predicted 772
7 SASI_Hs01_00091591 predicted 1202
8 SASI_Hs01_00091592 predicted 1233
9 SASI_Hs01_00091593 predicted 558
10 SASI_Hs01_00091594 predicted 1188
11 SASI_Hs01_00091589 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090977 predicted 1153
2 SASI_Rn01_00090978 predicted 1194
3 SASI_Rn01_00090979 predicted 1142
4 SASI_Rn01_00090980 predicted 917
5 SASI_Rn01_00090981 predicted 361
6 SASI_Rn01_00090982 predicted 376
7 SASI_Rn01_00090983 predicted 1197
8 SASI_Rn01_00090984 predicted 1145
9 SASI_Rn01_00090985 predicted 1054
10 SASI_Rn01_00090986 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317915 predicted 1167
2 SASI_Mm01_00172439 predicted 1341
3 SASI_Mm02_00317916 predicted 1275
4 SASI_Mm01_00172441 predicted 1359
5 SASI_Mm02_00317917 predicted 669
6 SASI_Mm01_00172442 predicted 1114
7 SASI_Mm02_00317918 predicted 1201
8 SASI_Mm01_00172445 predicted 584
9 SASI_Mm01_00172447 predicted 559
10 SASI_Mm02_00317919 predicted 1157
11 SASI_Mm01_00172440 predicted 517
12 SASI_Mm01_00172443 predicted 1230
13 SASI_Mm01_00172444 predicted 836
14 SASI_Mm01_00172446 predicted 1160
15 SASI_Mm01_00172448 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006558
VALIDATED
KHDRBS3 MISSION shRNA Bacterial Glycerol Stock
KH domain containing, RNA binding, signal transduction associated 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006558.1-715s1c1
Sequence:CCGGCAAGGAAGAAGAGTTGAGGAACTCGAGTTCCTCAACTCTTCTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-466s21c1
Sequence:CCGGGCGCCTGGTGAACCAAGAAATCTCGAGATTTCTTGGTTCACCAGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-1285s21c1
Sequence:CCGGTGGTGCTGATTACTATGATTACTCGAGTAATCATAGTAATCAGCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-691s1c1
Sequence:CCGGGAAAGGTTCCATGAGAGACAACTCGAGTTGTCTCTCATGGAACCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-527s21c1
Sequence:CCGGTACATCGATGTGGTGATTAATCTCGAGATTAATCACCACATCGATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-853s21c1
Sequence:CCGGGTTCCTCATCCCTGATTATAACTCGAGTTATAATCAGGGATGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006558.1-1545s21c1
Sequence:CCGGATCTGAATGGATGGAACTTAACTCGAGTTAAGTTCCATCCATTCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-1354s1c1
Sequence:CCGGGTGGACTAACTCAAGACACAACTCGAGTTGTGTCTTGAGTTAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-559s1c1
Sequence:CCGGGCTGGGACAGAAAGTGTTAATCTCGAGATTAACACTTTCTGTCCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-1211s1c1
Sequence:CCGGGATGGATATGGCACTGCTTATCTCGAGATAAGCAGTGCCATATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-633s1c1
Sequence:CCGGGTGGCAATTCTCTGAAGCGTTCTCGAGAACGCTTCAGAGAATTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006558
VALIDATED
KHDRBS3 MISSION shRNA shRNA Plasmid DNA
KH domain containing, RNA binding, signal transduction associated 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006558.1-715s1c1
Sequence:CCGGCAAGGAAGAAGAGTTGAGGAACTCGAGTTCCTCAACTCTTCTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-466s21c1
Sequence:CCGGGCGCCTGGTGAACCAAGAAATCTCGAGATTTCTTGGTTCACCAGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-1285s21c1
Sequence:CCGGTGGTGCTGATTACTATGATTACTCGAGTAATCATAGTAATCAGCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-691s1c1
Sequence:CCGGGAAAGGTTCCATGAGAGACAACTCGAGTTGTCTCTCATGGAACCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-527s21c1
Sequence:CCGGTACATCGATGTGGTGATTAATCTCGAGATTAATCACCACATCGATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-853s21c1
Sequence:CCGGGTTCCTCATCCCTGATTATAACTCGAGTTATAATCAGGGATGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006558.1-1545s21c1
Sequence:CCGGATCTGAATGGATGGAACTTAACTCGAGTTAAGTTCCATCCATTCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-1354s1c1
Sequence:CCGGGTGGACTAACTCAAGACACAACTCGAGTTGTGTCTTGAGTTAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-559s1c1
Sequence:CCGGGCTGGGACAGAAAGTGTTAATCTCGAGATTAACACTTTCTGTCCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-1211s1c1
Sequence:CCGGGATGGATATGGCACTGCTTATCTCGAGATAAGCAGTGCCATATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-633s1c1
Sequence:CCGGGTGGCAATTCTCTGAAGCGTTCTCGAGAACGCTTCAGAGAATTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006558
VALIDATED
KHDRBS3 MISSION shRNA Lentiviral Transduction Particles
KH domain containing, RNA binding, signal transduction associated 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006558.1-715s1c1
Sequence:CCGGCAAGGAAGAAGAGTTGAGGAACTCGAGTTCCTCAACTCTTCTTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-466s21c1
Sequence:CCGGGCGCCTGGTGAACCAAGAAATCTCGAGATTTCTTGGTTCACCAGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-1285s21c1
Sequence:CCGGTGGTGCTGATTACTATGATTACTCGAGTAATCATAGTAATCAGCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-691s1c1
Sequence:CCGGGAAAGGTTCCATGAGAGACAACTCGAGTTGTCTCTCATGGAACCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-527s21c1
Sequence:CCGGTACATCGATGTGGTGATTAATCTCGAGATTAATCACCACATCGATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006558.1-853s21c1
Sequence:CCGGGTTCCTCATCCCTGATTATAACTCGAGTTATAATCAGGGATGAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006558.1-1545s21c1
Sequence:CCGGATCTGAATGGATGGAACTTAACTCGAGTTAAGTTCCATCCATTCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-1354s1c1
Sequence:CCGGGTGGACTAACTCAAGACACAACTCGAGTTGTGTCTTGAGTTAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-559s1c1
Sequence:CCGGGCTGGGACAGAAAGTGTTAATCTCGAGATTAACACTTTCTGTCCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-1211s1c1
Sequence:CCGGGATGGATATGGCACTGCTTATCTCGAGATAAGCAGTGCCATATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006558.1-633s1c1
Sequence:CCGGGTGGCAATTCTCTGAAGCGTTCTCGAGAACGCTTCAGAGAATTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010158
VALIDATED
KHDRBS3 MISSION shRNA Bacterial Glycerol Stock
KH domain containing, RNA binding, signal transduction associated 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-1790s1c1
Sequence:CCGGGCCGATTACAAGTGCAGACAACTCGAGTTGTCTGCACTTGTAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010158.1-801s1c1
Sequence:CCGGTCCCTGACTATTATGATGAAACTCGAGTTTCATCATAATAGTCAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-1226s1c1
Sequence:CCGGGCAGCTGATTACTACGATTATCTCGAGATAATCGTAGTAATCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-475s1c1
Sequence:CCGGCGTGGTGATAAACAAGAACATCTCGAGATGTTCTTGTTTATCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010158.1-802s1c1
Sequence:CCGGCCCTGACTATTATGATGAAATCTCGAGATTTCATCATAATAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-1218s21c1
Sequence:CCGGGCAGCTGATTACTACGATTATCTCGAGATAATCGTAGTAATCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-1120s21c1
Sequence:CCGGCCTATGGAGAGTATGACTATGCTCGAGCATAGTCATACTCTCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010158.2-1782s21c1
Sequence:CCGGGCCGATTACAAGTGCAGACAACTCGAGTTGTCTGCACTTGTAATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-467s21c1
Sequence:CCGGCGTGGTGATAAACAAGAACATCTCGAGATGTTCTTGTTTATCACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010158
VALIDATED
KHDRBS3 MISSION shRNA shRNA Plasmid DNA
KH domain containing, RNA binding, signal transduction associated 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-1790s1c1
Sequence:CCGGGCCGATTACAAGTGCAGACAACTCGAGTTGTCTGCACTTGTAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010158.1-801s1c1
Sequence:CCGGTCCCTGACTATTATGATGAAACTCGAGTTTCATCATAATAGTCAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-1226s1c1
Sequence:CCGGGCAGCTGATTACTACGATTATCTCGAGATAATCGTAGTAATCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-475s1c1
Sequence:CCGGCGTGGTGATAAACAAGAACATCTCGAGATGTTCTTGTTTATCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010158.1-802s1c1
Sequence:CCGGCCCTGACTATTATGATGAAATCTCGAGATTTCATCATAATAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-1218s21c1
Sequence:CCGGGCAGCTGATTACTACGATTATCTCGAGATAATCGTAGTAATCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-1120s21c1
Sequence:CCGGCCTATGGAGAGTATGACTATGCTCGAGCATAGTCATACTCTCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010158.2-1782s21c1
Sequence:CCGGGCCGATTACAAGTGCAGACAACTCGAGTTGTCTGCACTTGTAATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-467s21c1
Sequence:CCGGCGTGGTGATAAACAAGAACATCTCGAGATGTTCTTGTTTATCACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010158
VALIDATED
KHDRBS3 MISSION shRNA Lentiviral Transduction Particles
KH domain containing, RNA binding, signal transduction associated 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102325    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-1790s1c1
Sequence:CCGGGCCGATTACAAGTGCAGACAACTCGAGTTGTCTGCACTTGTAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010158.1-801s1c1
Sequence:CCGGTCCCTGACTATTATGATGAAACTCGAGTTTCATCATAATAGTCAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-1226s1c1
Sequence:CCGGGCAGCTGATTACTACGATTATCTCGAGATAATCGTAGTAATCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010158.1-475s1c1
Sequence:CCGGCGTGGTGATAAACAAGAACATCTCGAGATGTTCTTGTTTATCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010158.1-802s1c1
Sequence:CCGGCCCTGACTATTATGATGAAATCTCGAGATTTCATCATAATAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-1218s21c1
Sequence:CCGGGCAGCTGATTACTACGATTATCTCGAGATAATCGTAGTAATCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-1120s21c1
Sequence:CCGGCCTATGGAGAGTATGACTATGCTCGAGCATAGTCATACTCTCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010158.2-1782s21c1
Sequence:CCGGGCCGATTACAAGTGCAGACAACTCGAGTTGTCTGCACTTGTAATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010158.2-467s21c1
Sequence:CCGGCGTGGTGATAAACAAGAACATCTCGAGATGTTCTTGTTTATCACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)