EMAIL THIS PAGE TO A FRIEND

KHK

ketohexokinase (fructokinase)

92 Gene Product Result for
UniProtKB ID: P50053, Q6IBK2, Q99532, Q9BRJ3, Q9UMN1
Gene ID:
Human(3795) Summary: This gene encodes ketohexokinase that catalyzes conversion of fructose to fructose-1-phosphate. The product of this gene is the first enzyme with a specialized pathway that catabolizes dietary fructose. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(16548) ketohexokinase
Rat(25659) ketohexokinase
Zebrafish(436909) ketohexokinase
cow(614868) ketohexokinase (fructokinase)
domestic cat(101080375) ketohexokinase (fructokinase)
dog(100170647) ketohexokinase (fructokinase)
domestic guinea pig(100719336) ketohexokinase (fructokinase)
naked mole-rat(101705832) ketohexokinase (fructokinase)
sheep(101113479) ketohexokinase (fructokinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000221 Rosetta Predictions human pricing
NM_006488 Rosetta Predictions human pricing
NM_031855 Rosetta Predictions rat pricing
XM_579542 Rosetta Predictions rat pricing
NM_008439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093008 predicted 1387
2 SASI_Hs01_00093009 predicted 1290
3 SASI_Hs01_00093010 predicted 1906
4 SASI_Hs01_00093011 predicted 1652
5 SASI_Hs01_00093012 predicted 1534
6 SASI_Hs02_00302115 predicted 1587
7 SASI_Hs02_00302116 predicted 1762
8 SASI_Hs01_00093013 predicted 1847
9 SASI_Hs01_00093014 predicted 1833
10 SASI_Hs01_00093015 predicted 1342
11 SASI_Hs01_00093016 predicted 1091
12 SASI_Hs01_00093017 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052408 predicted 1385
2 SASI_Hs01_00052409 predicted 1288
3 SASI_Hs01_00052410 predicted 1897
4 SASI_Hs01_00052411 predicted 1649
5 SASI_Hs01_00052412 predicted 1529
6 SASI_Hs02_00341682 predicted 1585
7 SASI_Hs02_00341683 predicted 1768
8 SASI_Hs01_00052413 predicted 1844
9 SASI_Hs01_00052414 predicted 1831
10 SASI_Hs01_00052415 predicted 1343
11 SASI_Hs01_00052416 predicted 1096
12 SASI_Hs01_00052417 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071508 predicted 400
2 SASI_Rn01_00071509 predicted 966
3 SASI_Rn01_00071510 predicted 618
4 SASI_Rn01_00071511 predicted 818
5 SASI_Rn02_00265350 predicted 718
6 SASI_Rn01_00071513 predicted 583
7 SASI_Rn01_00071514 predicted 635
8 SASI_Rn01_00071515 predicted 586
9 SASI_Rn01_00071516 predicted 642
10 SASI_Rn01_00071517 predicted 517
11 SASI_Rn01_00071512 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579542 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175717 predicted 264
2 SASI_Rn01_00175718 predicted 835
3 SASI_Rn01_00175719 predicted 490
4 SASI_Rn01_00175720 predicted 694
5 SASI_Rn01_00175721 predicted 414
6 SASI_Rn01_00175722 predicted 443
7 SASI_Rn01_00175723 predicted 511
8 SASI_Rn01_00175724 predicted 458
9 SASI_Rn01_00175725 predicted 514
10 SASI_Rn01_00175726 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313922 predicted 302
2 SASI_Mm01_00112304 predicted 259
3 SASI_Mm01_00112305 predicted 641
4 SASI_Mm01_00112306 predicted 405
5 SASI_Mm02_00313923 predicted 407
6 SASI_Mm01_00112309 predicted 226
7 SASI_Mm01_00112310 predicted 816
8 SASI_Mm01_00112311 predicted 472
9 SASI_Mm01_00112312 predicted 296
10 SASI_Mm01_00112313 predicted 422
11 SASI_Mm01_00112307 predicted 307
12 SASI_Mm01_00112308 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000221
VALIDATED
KHK MISSION shRNA Bacterial Glycerol Stock
ketohexokinase (fructokinase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_000221.1-87s1c1
Sequence:CCGGGACTCGGAGATAAGGTGTTTGCTCGAGCAAACACCTTATCTCCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000221.1-1713s1c1
Sequence:CCGGGCATATAATGTAAAGGGCTTTCTCGAGAAAGCCCTTTACATTATATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_000221.1-359s1c1
Sequence:CCGGGCCAGATGTGTCTGCTACAGACTCGAGTCTGTAGCAGACACATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000221.1-1328s1c1
Sequence:CCGGCCAGTGAACCTGCCAAAGAAACTCGAGTTTCTTTGGCAGGTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-372s1c1
Sequence:CCGGGCTACAGACTTTGAGAAGGTTCTCGAGAACCTTCTCAAAGTCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-78s1c1
Sequence:CCGGCCTAAGGAGGACTCGGAGATACTCGAGTATCTCCGAGTCCTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-458s1c1
Sequence:CCGGGCAGCGGATAGACGCACACAACTCGAGTTGTGTGCGTCTATCCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000221.1-237s1c1
Sequence:CCGGCGCCGCTATTCTGTGGACCTACTCGAGTAGGTCCACAGAATAGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000221.2-837s21c1
Sequence:GTACCGGGCCGCACCATCCTATACTATGCTCGAGCATAGTATAGGATGGTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000221
VALIDATED
KHK MISSION shRNA shRNA Plasmid DNA
ketohexokinase (fructokinase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_000221.1-87s1c1
Sequence:CCGGGACTCGGAGATAAGGTGTTTGCTCGAGCAAACACCTTATCTCCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000221.1-1713s1c1
Sequence:CCGGGCATATAATGTAAAGGGCTTTCTCGAGAAAGCCCTTTACATTATATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_000221.1-359s1c1
Sequence:CCGGGCCAGATGTGTCTGCTACAGACTCGAGTCTGTAGCAGACACATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000221.1-1328s1c1
Sequence:CCGGCCAGTGAACCTGCCAAAGAAACTCGAGTTTCTTTGGCAGGTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-372s1c1
Sequence:CCGGGCTACAGACTTTGAGAAGGTTCTCGAGAACCTTCTCAAAGTCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-78s1c1
Sequence:CCGGCCTAAGGAGGACTCGGAGATACTCGAGTATCTCCGAGTCCTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-458s1c1
Sequence:CCGGGCAGCGGATAGACGCACACAACTCGAGTTGTGTGCGTCTATCCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000221.1-237s1c1
Sequence:CCGGCGCCGCTATTCTGTGGACCTACTCGAGTAGGTCCACAGAATAGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000221.2-837s21c1
Sequence:GTACCGGGCCGCACCATCCTATACTATGCTCGAGCATAGTATAGGATGGTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000221
VALIDATED
KHK MISSION shRNA Lentiviral Transduction Particles
ketohexokinase (fructokinase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_000221.1-87s1c1
Sequence:CCGGGACTCGGAGATAAGGTGTTTGCTCGAGCAAACACCTTATCTCCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000221.1-1713s1c1
Sequence:CCGGGCATATAATGTAAAGGGCTTTCTCGAGAAAGCCCTTTACATTATATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_000221.1-359s1c1
Sequence:CCGGGCCAGATGTGTCTGCTACAGACTCGAGTCTGTAGCAGACACATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000221.1-1328s1c1
Sequence:CCGGCCAGTGAACCTGCCAAAGAAACTCGAGTTTCTTTGGCAGGTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-372s1c1
Sequence:CCGGGCTACAGACTTTGAGAAGGTTCTCGAGAACCTTCTCAAAGTCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-78s1c1
Sequence:CCGGCCTAAGGAGGACTCGGAGATACTCGAGTATCTCCGAGTCCTCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000221.1-458s1c1
Sequence:CCGGGCAGCGGATAGACGCACACAACTCGAGTTGTGTGCGTCTATCCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000221.1-237s1c1
Sequence:CCGGCGCCGCTATTCTGTGGACCTACTCGAGTAGGTCCACAGAATAGCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000221.2-837s21c1
Sequence:GTACCGGGCCGCACCATCCTATACTATGCTCGAGCATAGTATAGGATGGTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008439
VALIDATED
KHK MISSION shRNA Bacterial Glycerol Stock
ketohexokinase (fructokinase)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-79s1c1
Sequence:CCGGGTGGACAAATACCCAGAGGAACTCGAGTTCCTCTGGGTATTTGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-571s1c1
Sequence:CCGGAGCTATGGTGAGGTGGTGTTTCTCGAGAAACACCACCTCACCATAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008439.2-66s1c1
Sequence:CCGGCATCATCAATGTGGTGGACAACTCGAGTTGTCCACCACATTGATGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008439.2-471s1c1
Sequence:CCGGGCAGCGGATAGAGGAGCACAACTCGAGTTGTGCTCCTCTATCCGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-342s1c1
Sequence:CCGGCCGTACCATTATACTCTACGACTCGAGTCGTAGAGTATAATGGTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-523s21c1
Sequence:CCGGGTGTCGGTGGAGATAGAGAAGCTCGAGCTTCTCTATCTCCACCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-549s21c1
Sequence:CCGGTGAGGAGCTCTTCCAGTTGTTCTCGAGAACAACTGGAAGAGCTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-263s21c1
Sequence:CCGGTGGATGTGTCTCAAGTGACTTCTCGAGAAGTCACTTGAGACACATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-377s21c1
Sequence:CCGGATGTGTCTGCTAAGGACTTTGCTCGAGCAAAGTCCTTAGCAGACACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008439
VALIDATED
KHK MISSION shRNA shRNA Plasmid DNA
ketohexokinase (fructokinase)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-79s1c1
Sequence:CCGGGTGGACAAATACCCAGAGGAACTCGAGTTCCTCTGGGTATTTGTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-571s1c1
Sequence:CCGGAGCTATGGTGAGGTGGTGTTTCTCGAGAAACACCACCTCACCATAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008439.2-66s1c1
Sequence:CCGGCATCATCAATGTGGTGGACAACTCGAGTTGTCCACCACATTGATGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008439.2-471s1c1
Sequence:CCGGGCAGCGGATAGAGGAGCACAACTCGAGTTGTGCTCCTCTATCCGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-342s1c1
Sequence:CCGGCCGTACCATTATACTCTACGACTCGAGTCGTAGAGTATAATGGTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-523s21c1
Sequence:CCGGGTGTCGGTGGAGATAGAGAAGCTCGAGCTTCTCTATCTCCACCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-549s21c1
Sequence:CCGGTGAGGAGCTCTTCCAGTTGTTCTCGAGAACAACTGGAAGAGCTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-263s21c1
Sequence:CCGGTGGATGTGTCTCAAGTGACTTCTCGAGAAGTCACTTGAGACACATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-377s21c1
Sequence:CCGGATGTGTCTGCTAAGGACTTTGCTCGAGCAAAGTCCTTAGCAGACACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008439
VALIDATED
KHK MISSION shRNA Lentiviral Transduction Particles
ketohexokinase (fructokinase)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-79s1c1
Sequence:CCGGGTGGACAAATACCCAGAGGAACTCGAGTTCCTCTGGGTATTTGTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-571s1c1
Sequence:CCGGAGCTATGGTGAGGTGGTGTTTCTCGAGAAACACCACCTCACCATAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008439.2-66s1c1
Sequence:CCGGCATCATCAATGTGGTGGACAACTCGAGTTGTCCACCACATTGATGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008439.2-471s1c1
Sequence:CCGGGCAGCGGATAGAGGAGCACAACTCGAGTTGTGCTCCTCTATCCGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008439.2-342s1c1
Sequence:CCGGCCGTACCATTATACTCTACGACTCGAGTCGTAGAGTATAATGGTACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-523s21c1
Sequence:CCGGGTGTCGGTGGAGATAGAGAAGCTCGAGCTTCTCTATCTCCACCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-549s21c1
Sequence:CCGGTGAGGAGCTCTTCCAGTTGTTCTCGAGAACAACTGGAAGAGCTCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-263s21c1
Sequence:CCGGTGGATGTGTCTCAAGTGACTTCTCGAGAAGTCACTTGAGACACATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008439.3-377s21c1
Sequence:CCGGATGTGTCTGCTAAGGACTTTGCTCGAGCAAAGTCCTTAGCAGACACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)