EMAIL THIS PAGE TO A FRIEND

KHNYN

KH and NYN domain containing

188 Gene Product Result for
Synonyms: KIAA0323
UniProtKB ID: O15037, Q86TZ6, Q8IUQ2, Q96BA9
Gene ID:
Mouse(219094) KH and NYN domain containing
Rat(498517) KH and NYN domain containing
sheep(101112733) KH and NYN domain containing
Domestic Rabbit(100351687) KH and NYN domain containing
domestic guinea pig(100730286) KH and NYN domain containing
naked mole-rat(101715679) KH and NYN domain containing
dog(100683998) KH and NYN domain containing
cow(100124517) KH and NYN domain containing
domestic cat(101084289) KH and NYN domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015299 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009141 MISSION® esiRNA esiRNA targeting mouse 9130227C08Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015299 Rosetta Predictions human pricing
XM_001056714 Rosetta Predictions rat pricing
XM_573778 Rosetta Predictions rat pricing
NM_027143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153405 predicted 2024
2 SASI_Hs01_00153406 predicted 1895
3 SASI_Hs02_00347508 predicted 1998
4 SASI_Hs01_00153408 predicted 628
5 SASI_Hs01_00153409 predicted 260
6 SASI_Hs01_00153410 predicted 1804
7 SASI_Hs01_00153411 predicted 2179
8 SASI_Hs01_00153412 predicted 550
9 SASI_Hs01_00153413 predicted 550
10 SASI_Hs01_00153414 predicted 1481
11 SASI_Hs01_00153407 predicted 1865
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284189 predicted 372
2 SASI_Rn02_00284190 predicted 310
3 SASI_Rn02_00284191 predicted 1870
4 SASI_Rn02_00284192 predicted 1818
5 SASI_Rn02_00284193 predicted 297
6 SASI_Rn02_00284194 predicted 347
7 SASI_Rn02_00284195 predicted 568
8 SASI_Rn02_00284196 predicted 548
9 SASI_Rn02_00284197 predicted 1768
10 SASI_Rn02_00284198 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400751 predicted 372
2 SASI_Rn02_00400752 predicted 307
3 SASI_Rn02_00400753 predicted 283
4 SASI_Rn02_00400754 predicted 867
5 SASI_Rn02_00400755 predicted 294
6 SASI_Rn02_00400756 predicted 832
7 SASI_Rn02_00400757 predicted 346
8 SASI_Rn02_00400758 predicted 458
9 SASI_Rn02_00400759 predicted 563
10 SASI_Rn02_00400760 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114643 predicted 302
2 SASI_Mm01_00114644 predicted 1545
3 SASI_Mm01_00114645 predicted 1821
4 SASI_Mm01_00114646 predicted 2214
5 SASI_Mm01_00114647 predicted 1113
6 SASI_Mm01_00114649 predicted 1979
7 SASI_Mm01_00114650 predicted 595
8 SASI_Mm01_00114651 predicted 901
9 SASI_Mm01_00114652 predicted 335
10 SASI_Mm02_00331642 predicted 654
11 SASI_Mm01_00114648 predicted 2190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027143
KHNYN MISSION shRNA Bacterial Glycerol Stock
KH and NYN domain containing
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027143.2-2221s21c1
Sequence:CCGGGCATAGCTGCTGCCCTATTAGCTCGAGCTAATAGGGCAGCAGCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027143.1-3565s1c1
Sequence:CCGGCCCAGGAGTAATTTAGGGCTACTCGAGTAGCCCTAAATTACTCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-2150s21c1
Sequence:CCGGACCGTACTGCCGGGATATTAACTCGAGTTAATATCCCGGCAGTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1471s21c1
Sequence:CCGGAGCCAGATCTCCGTCACATTGCTCGAGCAATGTGACGGAGATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1591s21c1
Sequence:CCGGACCGTGACATAACCGTCTTTGCTCGAGCAAAGACGGTTATGTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027143.1-340s1c1
Sequence:CCGGCCTCATATCTGGTTGCAGCTTCTCGAGAAGCTGCAACCAGATATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1899s21c1
Sequence:CCGGGATGACCCACTGGGACGAAATCTCGAGATTTCGTCCCAGTGGGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027143
KHNYN MISSION shRNA shRNA Plasmid DNA
KH and NYN domain containing
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027143.2-2221s21c1
Sequence:CCGGGCATAGCTGCTGCCCTATTAGCTCGAGCTAATAGGGCAGCAGCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027143.1-3565s1c1
Sequence:CCGGCCCAGGAGTAATTTAGGGCTACTCGAGTAGCCCTAAATTACTCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-2150s21c1
Sequence:CCGGACCGTACTGCCGGGATATTAACTCGAGTTAATATCCCGGCAGTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1471s21c1
Sequence:CCGGAGCCAGATCTCCGTCACATTGCTCGAGCAATGTGACGGAGATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1591s21c1
Sequence:CCGGACCGTGACATAACCGTCTTTGCTCGAGCAAAGACGGTTATGTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027143.1-340s1c1
Sequence:CCGGCCTCATATCTGGTTGCAGCTTCTCGAGAAGCTGCAACCAGATATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1899s21c1
Sequence:CCGGGATGACCCACTGGGACGAAATCTCGAGATTTCGTCCCAGTGGGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027143
KHNYN MISSION shRNA Lentiviral Transduction Particles
KH and NYN domain containing
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027143.2-2221s21c1
Sequence:CCGGGCATAGCTGCTGCCCTATTAGCTCGAGCTAATAGGGCAGCAGCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027143.1-3565s1c1
Sequence:CCGGCCCAGGAGTAATTTAGGGCTACTCGAGTAGCCCTAAATTACTCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-2150s21c1
Sequence:CCGGACCGTACTGCCGGGATATTAACTCGAGTTAATATCCCGGCAGTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1471s21c1
Sequence:CCGGAGCCAGATCTCCGTCACATTGCTCGAGCAATGTGACGGAGATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1591s21c1
Sequence:CCGGACCGTGACATAACCGTCTTTGCTCGAGCAAAGACGGTTATGTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027143.1-340s1c1
Sequence:CCGGCCTCATATCTGGTTGCAGCTTCTCGAGAAGCTGCAACCAGATATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027143.2-1899s21c1
Sequence:CCGGGATGACCCACTGGGACGAAATCTCGAGATTTCGTCCCAGTGGGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015299
VALIDATED
KHNYN MISSION shRNA Bacterial Glycerol Stock
KH and NYN domain containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-1799s21c1
Sequence:CCGGGAAGAGACAGATGGGATAATTCTCGAGAATTATCCCATCTGTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-1509s21c1
Sequence:CCGGACCTCCGCCATATTGTCATTGCTCGAGCAATGACAATATGGCGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1636s1c1
Sequence:CCGGCCAAAGTCAGAGAGAGTCACTCTCGAGAGTGACTCTCTCTGACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-4678s1c1
Sequence:CCGGGCCAAGGTTAGTGAGACAATTCTCGAGAATTGTCTCACTAACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1587s1c1
Sequence:CCGGCACCGTGACATAACTGTCTTTCTCGAGAAAGACAGTTATGTCACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1859s1c1
Sequence:CCGGGCCCTTTACCTTTGTGGGAAACTCGAGTTTCCCACAAAGGTAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015299.1-3359s1c1
Sequence:CCGGCGGAAGTTGAACCAGTTGGTTCTCGAGAACCAACTGGTTCAACTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-2027s21c1
Sequence:CCGGGGCTTTGCAGAACATGGTAAACTCGAGTTTACCATGTTCTGCAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015299.2-3027s21c1
Sequence:CCGGCACTATAACGTGCCCTATAATCTCGAGATTATAGGGCACGTTATAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-916s21c1
Sequence:CCGGATCTATGGGACCCGGAGATTGCTCGAGCAATCTCCGGGTCCCATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015299
VALIDATED
KHNYN MISSION shRNA shRNA Plasmid DNA
KH and NYN domain containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-1799s21c1
Sequence:CCGGGAAGAGACAGATGGGATAATTCTCGAGAATTATCCCATCTGTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-1509s21c1
Sequence:CCGGACCTCCGCCATATTGTCATTGCTCGAGCAATGACAATATGGCGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1636s1c1
Sequence:CCGGCCAAAGTCAGAGAGAGTCACTCTCGAGAGTGACTCTCTCTGACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-4678s1c1
Sequence:CCGGGCCAAGGTTAGTGAGACAATTCTCGAGAATTGTCTCACTAACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1587s1c1
Sequence:CCGGCACCGTGACATAACTGTCTTTCTCGAGAAAGACAGTTATGTCACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1859s1c1
Sequence:CCGGGCCCTTTACCTTTGTGGGAAACTCGAGTTTCCCACAAAGGTAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015299.1-3359s1c1
Sequence:CCGGCGGAAGTTGAACCAGTTGGTTCTCGAGAACCAACTGGTTCAACTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-2027s21c1
Sequence:CCGGGGCTTTGCAGAACATGGTAAACTCGAGTTTACCATGTTCTGCAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015299.2-3027s21c1
Sequence:CCGGCACTATAACGTGCCCTATAATCTCGAGATTATAGGGCACGTTATAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-916s21c1
Sequence:CCGGATCTATGGGACCCGGAGATTGCTCGAGCAATCTCCGGGTCCCATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015299
VALIDATED
KHNYN MISSION shRNA Lentiviral Transduction Particles
KH and NYN domain containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-1799s21c1
Sequence:CCGGGAAGAGACAGATGGGATAATTCTCGAGAATTATCCCATCTGTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-1509s21c1
Sequence:CCGGACCTCCGCCATATTGTCATTGCTCGAGCAATGACAATATGGCGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1636s1c1
Sequence:CCGGCCAAAGTCAGAGAGAGTCACTCTCGAGAGTGACTCTCTCTGACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-4678s1c1
Sequence:CCGGGCCAAGGTTAGTGAGACAATTCTCGAGAATTGTCTCACTAACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1587s1c1
Sequence:CCGGCACCGTGACATAACTGTCTTTCTCGAGAAAGACAGTTATGTCACGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_015299.1-1859s1c1
Sequence:CCGGGCCCTTTACCTTTGTGGGAAACTCGAGTTTCCCACAAAGGTAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015299.1-3359s1c1
Sequence:CCGGCGGAAGTTGAACCAGTTGGTTCTCGAGAACCAACTGGTTCAACTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-2027s21c1
Sequence:CCGGGGCTTTGCAGAACATGGTAAACTCGAGTTTACCATGTTCTGCAAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015299.2-3027s21c1
Sequence:CCGGCACTATAACGTGCCCTATAATCTCGAGATTATAGGGCACGTTATAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015299.2-916s21c1
Sequence:CCGGATCTATGGGACCCGGAGATTGCTCGAGCAATCTCCGGGTCCCATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)