EMAIL THIS PAGE TO A FRIEND

KHSRP

KH-type splicing regulatory protein

103 Gene Product Result for
Synonyms: FBP2 FUBP2 KSRP
UniProtKB ID: Q92945, O00301, Q59EZ9, Q5U4P6, Q9UNT5, Q9UQH5
Gene ID:
Human(8570) Summary: The KHSRP gene encodes a multifunctional RNA-binding protein implicated in a variety of cellular processes, including transcription, alternative pre-mRNA splicing, and mRNA localization (Min et al., 1997 [PubMed 9136930]
Mouse(16549) KH-type splicing regulatory protein
Rat(171137) KH-type splicing regulatory protein
Zebrafish(573145) KH-type splicing regulatory protein
cow(505564) KH-type splicing regulatory protein
Horse(100065608) KH-type splicing regulatory protein
dog(485022) KH-type splicing regulatory protein
chicken(374140) KH-type splicing regulatory protein
domestic cat(101086208) KH-type splicing regulatory protein
domestic guinea pig(100721745) KH-type splicing regulatory protein
naked mole-rat(101721809) KH-type splicing regulatory protein
sheep(101109446) KH-type splicing regulatory protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200567 Anti-KHSRP (C-terminal) antibody produced in rabbit IgG fraction of antiserum human, mouse, rat
western blot pricing
SAB2108168 Anti-KHSRP antibody produced in rabbit affinity isolated antibody bovine, dog, guinea pig, human, horse, rat, mouse
immunohistochemistry, western blot pricing
SAB2101240 Anti-KHSRP antibody produced in rabbit affinity isolated antibody, lyophilized powder zebrafish, canine, human, rabbit, rat, mouse, horse, chicken, bovine
western blot pricing
HPA034739 Anti-KHSRP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200566 Anti-KHSRP antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse, rat
immunoprecipitation (IP), western blot pricing
HPA056518 Anti-KHSRP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0008570M1 Monoclonal Anti-KHSRP antibody produced in mouse clone 4C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200600 Monoclonal Anti-KHSRP antibody produced in mouse clone KS-8, purified immunoglobulin human, canine, rat, mouse, hamster, chicken, bovine
flow cytometry, immunocytochemistry, immunofluorescence, western blot pricing
SAB1404603 Monoclonal Anti-KHSRP antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409919 Monoclonal Anti-KHSRP antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409920 Monoclonal Anti-KHSRP antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB4200601 Monoclonal Anti-SLC5A7 antibody produced in mouse ~1.0 mg/mL, clone 62-2E8, purified immunoglobulin chicken, monkey, mouse, bovine, human, canine
immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003685 Rosetta Predictions human pricing
NM_133602 Rosetta Predictions rat pricing
NM_010613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230598 predicted 919
2 SASI_Hs01_00230599 predicted 718
3 SASI_Hs02_00336096 predicted 531
4 SASI_Hs01_00230600 predicted 1098
5 SASI_Hs01_00230601 predicted 897
6 SASI_Hs01_00230602 predicted 1567
7 SASI_Hs01_00230603 predicted 993
8 SASI_Hs01_00230604 predicted 486
9 SASI_Hs01_00230605 predicted 1202
10 SASI_Hs01_00230606 predicted 561
11 SASI_Hs01_00230607 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091420 predicted 1053
2 SASI_Rn01_00091421 predicted 1139
3 SASI_Rn01_00091422 predicted 987
4 SASI_Rn02_00267821 predicted 1467
5 SASI_Rn01_00091423 predicted 838
6 SASI_Rn02_00267822 predicted 1062
7 SASI_Rn01_00091426 predicted 655
8 SASI_Rn02_00267823 predicted 1038
9 SASI_Rn02_00267824 predicted 839
10 SASI_Rn01_00091427 predicted 522
11 SASI_Rn01_00091424 predicted 465
12 SASI_Rn01_00091425 predicted 689
13 SASI_Rn01_00091428 predicted 570
14 SASI_Rn01_00091429 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318932 predicted 716
2 SASI_Mm02_00318933 predicted 565
3 SASI_Mm02_00318934 predicted 634
4 SASI_Mm02_00318935 predicted 483
5 SASI_Mm02_00318936 predicted 988
6 SASI_Mm02_00318937 predicted 539
7 SASI_Mm02_00318938 predicted 1657
8 SASI_Mm01_00109722 predicted 1047
9 SASI_Mm01_00109723 predicted 1019
10 SASI_Mm02_00318939 predicted 538
11 SASI_Mm01_00109720 predicted 1184
12 SASI_Mm01_00109721 predicted 1129
13 SASI_Mm01_00109724 predicted 1365
14 SASI_Mm01_00109725 predicted 2131
15 SASI_Mm01_00109726 predicted 1059
16 SASI_Mm01_00109727 predicted 1041
17 SASI_Mm01_00109728 predicted 752
18 SASI_Mm01_00109729 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003685
VALIDATED
KHSRP MISSION shRNA Bacterial Glycerol Stock
KH-type splicing regulatory protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-1841s21c1
Sequence:CCGGCGCCTACTACTCACACTACTACTCGAGTAGTAGTGTGAGTAGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-1206s21c1
Sequence:CCGGCCCGAGAAGATTGCTCATATACTCGAGTATATGAGCAATCTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-897s21c1
Sequence:CCGGGCTGGAGTGAAGATGATCTTACTCGAGTAAGATCATCTTCACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-1189s1c1
Sequence:CCGGCCCGAGAAGATTGCTCATATACTCGAGTATATGAGCAATCTTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003685.1-880s1c1
Sequence:CCGGGCTGGAGTGAAGATGATCTTACTCGAGTAAGATCATCTTCACTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-536s21c1
Sequence:CCGGGACTTCAATGACAGAAGAGTACTCGAGTACTCTTCTGTCATTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-2620s1c1
Sequence:CCGGCTGAGGATAAAGCAATTCATTCTCGAGAATGAATTGCTTTATCCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-519s1c1
Sequence:CCGGGACTTCAATGACAGAAGAGTACTCGAGTACTCTTCTGTCATTGAAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-1824s1c1
Sequence:CCGGCGCCTACTACTCACACTACTACTCGAGTAGTAGTGTGAGTAGTAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003685
VALIDATED
KHSRP MISSION shRNA shRNA Plasmid DNA
KH-type splicing regulatory protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-1841s21c1
Sequence:CCGGCGCCTACTACTCACACTACTACTCGAGTAGTAGTGTGAGTAGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-1206s21c1
Sequence:CCGGCCCGAGAAGATTGCTCATATACTCGAGTATATGAGCAATCTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-897s21c1
Sequence:CCGGGCTGGAGTGAAGATGATCTTACTCGAGTAAGATCATCTTCACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-1189s1c1
Sequence:CCGGCCCGAGAAGATTGCTCATATACTCGAGTATATGAGCAATCTTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003685.1-880s1c1
Sequence:CCGGGCTGGAGTGAAGATGATCTTACTCGAGTAAGATCATCTTCACTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-536s21c1
Sequence:CCGGGACTTCAATGACAGAAGAGTACTCGAGTACTCTTCTGTCATTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-2620s1c1
Sequence:CCGGCTGAGGATAAAGCAATTCATTCTCGAGAATGAATTGCTTTATCCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-519s1c1
Sequence:CCGGGACTTCAATGACAGAAGAGTACTCGAGTACTCTTCTGTCATTGAAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-1824s1c1
Sequence:CCGGCGCCTACTACTCACACTACTACTCGAGTAGTAGTGTGAGTAGTAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003685
VALIDATED
KHSRP MISSION shRNA Lentiviral Transduction Particles
KH-type splicing regulatory protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-1841s21c1
Sequence:CCGGCGCCTACTACTCACACTACTACTCGAGTAGTAGTGTGAGTAGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-1206s21c1
Sequence:CCGGCCCGAGAAGATTGCTCATATACTCGAGTATATGAGCAATCTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-897s21c1
Sequence:CCGGGCTGGAGTGAAGATGATCTTACTCGAGTAAGATCATCTTCACTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-1189s1c1
Sequence:CCGGCCCGAGAAGATTGCTCATATACTCGAGTATATGAGCAATCTTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003685.1-880s1c1
Sequence:CCGGGCTGGAGTGAAGATGATCTTACTCGAGTAAGATCATCTTCACTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003685.2-536s21c1
Sequence:CCGGGACTTCAATGACAGAAGAGTACTCGAGTACTCTTCTGTCATTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-2620s1c1
Sequence:CCGGCTGAGGATAAAGCAATTCATTCTCGAGAATGAATTGCTTTATCCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-519s1c1
Sequence:CCGGGACTTCAATGACAGAAGAGTACTCGAGTACTCTTCTGTCATTGAAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003685.1-1824s1c1
Sequence:CCGGCGCCTACTACTCACACTACTACTCGAGTAGTAGTGTGAGTAGTAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010613
KHSRP MISSION shRNA Bacterial Glycerol Stock
KH-type splicing regulatory protein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1181s1c2
Sequence:CCGGCCCTGAGAAGATTGCTCACATCTCGAGATGTGAGCAATCTTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1947s1c1
Sequence:CCGGGCTTGGGAAGAGTATTACAAACTCGAGTTTGTAATACTCTTCCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010613.2-3184s1c1
Sequence:CCGGGCAAATGGATATGAACTTCATCTCGAGATGAAGTTCATATCCATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1529s1c1
Sequence:CCGGCCAGCAGATTGACCATGCAAACTCGAGTTTGCATGGTCAATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1149s1c1
Sequence:CCGGCGCATCCAGTTCAAGCAAGATCTCGAGATCTTGCTTGAACTGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1181s1c1
Sequence:CCGGCCCTGAGAAGATTGCTCACATCTCGAGATGTGAGCAATCTTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010613
KHSRP MISSION shRNA shRNA Plasmid DNA
KH-type splicing regulatory protein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1181s1c2
Sequence:CCGGCCCTGAGAAGATTGCTCACATCTCGAGATGTGAGCAATCTTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1947s1c1
Sequence:CCGGGCTTGGGAAGAGTATTACAAACTCGAGTTTGTAATACTCTTCCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010613.2-3184s1c1
Sequence:CCGGGCAAATGGATATGAACTTCATCTCGAGATGAAGTTCATATCCATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1529s1c1
Sequence:CCGGCCAGCAGATTGACCATGCAAACTCGAGTTTGCATGGTCAATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1149s1c1
Sequence:CCGGCGCATCCAGTTCAAGCAAGATCTCGAGATCTTGCTTGAACTGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1181s1c1
Sequence:CCGGCCCTGAGAAGATTGCTCACATCTCGAGATGTGAGCAATCTTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010613
KHSRP MISSION shRNA Lentiviral Transduction Particles
KH-type splicing regulatory protein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1181s1c2
Sequence:CCGGCCCTGAGAAGATTGCTCACATCTCGAGATGTGAGCAATCTTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1947s1c1
Sequence:CCGGGCTTGGGAAGAGTATTACAAACTCGAGTTTGTAATACTCTTCCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010613.2-3184s1c1
Sequence:CCGGGCAAATGGATATGAACTTCATCTCGAGATGAAGTTCATATCCATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1529s1c1
Sequence:CCGGCCAGCAGATTGACCATGCAAACTCGAGTTTGCATGGTCAATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1149s1c1
Sequence:CCGGCGCATCCAGTTCAAGCAAGATCTCGAGATCTTGCTTGAACTGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010613.2-1181s1c1
Sequence:CCGGCCCTGAGAAGATTGCTCACATCTCGAGATGTGAGCAATCTTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)