EMAIL THIS PAGE TO A FRIEND

KIAA0020

KIAA0020

38 Gene Product Result for
Synonyms: HA-8 HLA-HA8 PEN PUF6 XTP5 hPUF-A
Gene ID:
chicken(427350) KIAA0020
cow(514957) KIAA0020
domestic cat(101090396) KIAA0020 ortholog
dog(476337) KIAA0020 ortholog
sheep(101110997) KIAA0020 ortholog
domestic guinea pig(100722087) KIAA0020 ortholog
naked mole-rat(101710010) KIAA0020 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014878 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001141 MISSION® esiRNA esiRNA targeting human KIAA0020 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031691 Rosetta Predictions human pricing
NM_014878 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131775 predicted 1392
2 SASI_Hs01_00131776 predicted 1492
3 SASI_Hs01_00131777 predicted 1398
4 SASI_Hs01_00131778 predicted 1359
5 SASI_Hs01_00131779 predicted 404
6 SASI_Hs01_00131780 predicted 513
7 SASI_Hs01_00131781 predicted 384
8 SASI_Hs01_00131782 predicted 1455
9 SASI_Hs01_00131783 predicted 517
10 SASI_Hs01_00131784 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137511 predicted 1485
2 SASI_Hs02_00346489 predicted 952
3 SASI_Hs01_00137513 predicted 1583
4 SASI_Hs02_00346490 predicted 490
5 SASI_Hs02_00346491 predicted 915
6 SASI_Hs01_00137517 predicted 604
7 SASI_Hs02_00346492 predicted 223
8 SASI_Hs02_00346493 predicted 1053
9 SASI_Hs02_00346494 predicted 1900
10 SASI_Hs01_00137518 predicted 1548
11 SASI_Hs01_00137512 predicted 637
12 SASI_Hs01_00137514 predicted 1403
13 SASI_Hs01_00137515 predicted 1354
14 SASI_Hs01_00137516 predicted 1241
15 SASI_Hs01_00137519 predicted 513
16 SASI_Hs01_00137520 predicted 1522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014878
VALIDATED
KIAA0020 MISSION shRNA Bacterial Glycerol Stock
KIAA0020
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-2055s21c1
Sequence:CCGGTAAGAGCAAGATGGAATGATTCTCGAGAATCATTCCATCTTGCTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1880s21c1
Sequence:CCGGGTGTAAATCGAGGTGCCATTACTCGAGTAATGGCACCTCGATTTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1997s21c1
Sequence:CCGGGCACCAGCAAAGGAATAGAAACTCGAGTTTCTATTCCTTTGCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-604s1c1
Sequence:CCGGGCGAGATGATTTGGTTGAGTTCTCGAGAACTCAACCAAATCATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1869s1c1
Sequence:CCGGGCTTGATTCCTACACTGGAAACTCGAGTTTCCAGTGTAGGAATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-637s21c1
Sequence:CCGGCGTGTGATCCAGTGTTACATTCTCGAGAATGTAACACTGGATCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1285s1c1
Sequence:CCGGGCCTAGCATAGTAAATGACAACTCGAGTTGTCATTTACTATGCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014878.3-1214s1c1
Sequence:CCGGGCGGCATTTGATTGTATTGATCTCGAGATCAATACAATCAAATGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-769s1c1
Sequence:CCGGCGCATACAATGACAAAGCCATCTCGAGATGGCTTTGTCATTGTATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1211s1c1
Sequence:CCGGCTGGCGGCATTTGATTGTATTCTCGAGAATACAATCAAATGCCGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1899s1c1
Sequence:CCGGGCACCAGCAAAGGAATAGAAACTCGAGTTTCTATTCCTTTGCTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014878.3-1631s1c1
Sequence:CCGGGAGCTTCACATTGCAGAACATCTCGAGATGTTCTGCAATGTGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1747s1c1
Sequence:CCGGGCATGTTGGTATGAAGAACCTCTCGAGAGGTTCTTCATACCAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1782s1c1
Sequence:CCGGGTGTAAATCGAGGTGCCATTACTCGAGTAATGGCACCTCGATTTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-539s1c1
Sequence:CCGGCGTGTGATCCAGTGTTACATTCTCGAGAATGTAACACTGGATCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1383s21c1
Sequence:CCGGGCCTAGCATAGTAAATGACAACTCGAGTTGTCATTTACTATGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014878
VALIDATED
KIAA0020 MISSION shRNA shRNA Plasmid DNA
KIAA0020
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-2055s21c1
Sequence:CCGGTAAGAGCAAGATGGAATGATTCTCGAGAATCATTCCATCTTGCTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1880s21c1
Sequence:CCGGGTGTAAATCGAGGTGCCATTACTCGAGTAATGGCACCTCGATTTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1997s21c1
Sequence:CCGGGCACCAGCAAAGGAATAGAAACTCGAGTTTCTATTCCTTTGCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-604s1c1
Sequence:CCGGGCGAGATGATTTGGTTGAGTTCTCGAGAACTCAACCAAATCATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1869s1c1
Sequence:CCGGGCTTGATTCCTACACTGGAAACTCGAGTTTCCAGTGTAGGAATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-637s21c1
Sequence:CCGGCGTGTGATCCAGTGTTACATTCTCGAGAATGTAACACTGGATCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1285s1c1
Sequence:CCGGGCCTAGCATAGTAAATGACAACTCGAGTTGTCATTTACTATGCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014878.3-1214s1c1
Sequence:CCGGGCGGCATTTGATTGTATTGATCTCGAGATCAATACAATCAAATGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-769s1c1
Sequence:CCGGCGCATACAATGACAAAGCCATCTCGAGATGGCTTTGTCATTGTATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1211s1c1
Sequence:CCGGCTGGCGGCATTTGATTGTATTCTCGAGAATACAATCAAATGCCGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1899s1c1
Sequence:CCGGGCACCAGCAAAGGAATAGAAACTCGAGTTTCTATTCCTTTGCTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014878.3-1631s1c1
Sequence:CCGGGAGCTTCACATTGCAGAACATCTCGAGATGTTCTGCAATGTGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1747s1c1
Sequence:CCGGGCATGTTGGTATGAAGAACCTCTCGAGAGGTTCTTCATACCAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1782s1c1
Sequence:CCGGGTGTAAATCGAGGTGCCATTACTCGAGTAATGGCACCTCGATTTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-539s1c1
Sequence:CCGGCGTGTGATCCAGTGTTACATTCTCGAGAATGTAACACTGGATCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1383s21c1
Sequence:CCGGGCCTAGCATAGTAAATGACAACTCGAGTTGTCATTTACTATGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014878
VALIDATED
KIAA0020 MISSION shRNA Lentiviral Transduction Particles
KIAA0020
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280663    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-2055s21c1
Sequence:CCGGTAAGAGCAAGATGGAATGATTCTCGAGAATCATTCCATCTTGCTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1880s21c1
Sequence:CCGGGTGTAAATCGAGGTGCCATTACTCGAGTAATGGCACCTCGATTTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1997s21c1
Sequence:CCGGGCACCAGCAAAGGAATAGAAACTCGAGTTTCTATTCCTTTGCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-604s1c1
Sequence:CCGGGCGAGATGATTTGGTTGAGTTCTCGAGAACTCAACCAAATCATCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1869s1c1
Sequence:CCGGGCTTGATTCCTACACTGGAAACTCGAGTTTCCAGTGTAGGAATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-637s21c1
Sequence:CCGGCGTGTGATCCAGTGTTACATTCTCGAGAATGTAACACTGGATCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1285s1c1
Sequence:CCGGGCCTAGCATAGTAAATGACAACTCGAGTTGTCATTTACTATGCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014878.3-1214s1c1
Sequence:CCGGGCGGCATTTGATTGTATTGATCTCGAGATCAATACAATCAAATGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-769s1c1
Sequence:CCGGCGCATACAATGACAAAGCCATCTCGAGATGGCTTTGTCATTGTATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1211s1c1
Sequence:CCGGCTGGCGGCATTTGATTGTATTCTCGAGAATACAATCAAATGCCGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1899s1c1
Sequence:CCGGGCACCAGCAAAGGAATAGAAACTCGAGTTTCTATTCCTTTGCTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014878.3-1631s1c1
Sequence:CCGGGAGCTTCACATTGCAGAACATCTCGAGATGTTCTGCAATGTGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1747s1c1
Sequence:CCGGGCATGTTGGTATGAAGAACCTCTCGAGAGGTTCTTCATACCAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-1782s1c1
Sequence:CCGGGTGTAAATCGAGGTGCCATTACTCGAGTAATGGCACCTCGATTTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014878.3-539s1c1
Sequence:CCGGCGTGTGATCCAGTGTTACATTCTCGAGAATGTAACACTGGATCACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014878.4-1383s21c1
Sequence:CCGGGCCTAGCATAGTAAATGACAACTCGAGTTGTCATTTACTATGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)