EMAIL THIS PAGE TO A FRIEND

KIAA0040

KIAA0040

25 Gene Product Result for
UniProtKB ID: Q15053, A8K9H6, Q2NKQ0
Gene ID:
chicken(424434) KIAA0040
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014656 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014656 Rosetta Predictions human pricing
NR_015350 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228442 predicted 1481
2 SASI_Hs01_00228443 predicted 1879
3 SASI_Hs01_00228444 predicted 1612
4 SASI_Hs01_00228445 predicted 1846
5 SASI_Hs01_00228446 predicted 1543
6 SASI_Hs01_00228447 predicted 1453
7 SASI_Hs01_00228448 predicted 1617
8 SASI_Hs01_00228449 predicted 1786
9 SASI_Hs01_00228450 predicted 1876
10 SASI_Hs01_00228451 predicted 1834
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381112 predicted 423
2 SASI_Hs02_00381113 predicted 394
3 SASI_Hs02_00381114 predicted 424
4 SASI_Hs02_00381115 predicted 394
5 SASI_Hs02_00381116 predicted 400
6 SASI_Hs02_00381117 predicted 441
7 SASI_Hs02_00381118 predicted 425
8 SASI_Hs02_00381119 predicted 447
9 SASI_Hs02_00381120 predicted 419
10 SASI_Hs02_00381121 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014656
KIAA0040 MISSION shRNA Bacterial Glycerol Stock
KIAA0040
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1312s1c1
Sequence:CCGGCCTTGCCAGATTCAGACACATCTCGAGATGTGTCTGAATCTGGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014656.1-3108s1c1
Sequence:CCGGCCGGGACCATACAAGTAACATCTCGAGATGTTACTTGTATGGTCCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1011s1c1
Sequence:CCGGCGTGGACAATTCTTGGATACTCTCGAGAGTATCCAAGAATTGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1235s1c1
Sequence:CCGGCATCAAATGGTCATTGGCTATCTCGAGATAGCCAATGACCATTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1273s1c1
Sequence:CCGGGTACATTATCTACAGTCACAACTCGAGTTGTGACTGTAGATAATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014656.2-841s21c1
Sequence:CCGGCATCACTGCCTGTTTAGTTAGCTCGAGCTAACTAAACAGGCAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014656.2-661s21c1
Sequence:CCGGTGCCACTCTTGGTGATCATCACTCGAGTGATGATCACCAAGAGTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014656.2-953s21c1
Sequence:CCGGCATGTCCACAGAGTAACTACTCTCGAGAGTAGTTACTCTGTGGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014656
KIAA0040 MISSION shRNA shRNA Plasmid DNA
KIAA0040
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1312s1c1
Sequence:CCGGCCTTGCCAGATTCAGACACATCTCGAGATGTGTCTGAATCTGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014656.1-3108s1c1
Sequence:CCGGCCGGGACCATACAAGTAACATCTCGAGATGTTACTTGTATGGTCCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1011s1c1
Sequence:CCGGCGTGGACAATTCTTGGATACTCTCGAGAGTATCCAAGAATTGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1235s1c1
Sequence:CCGGCATCAAATGGTCATTGGCTATCTCGAGATAGCCAATGACCATTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1273s1c1
Sequence:CCGGGTACATTATCTACAGTCACAACTCGAGTTGTGACTGTAGATAATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014656.2-841s21c1
Sequence:CCGGCATCACTGCCTGTTTAGTTAGCTCGAGCTAACTAAACAGGCAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014656.2-661s21c1
Sequence:CCGGTGCCACTCTTGGTGATCATCACTCGAGTGATGATCACCAAGAGTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014656.2-953s21c1
Sequence:CCGGCATGTCCACAGAGTAACTACTCTCGAGAGTAGTTACTCTGTGGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014656
KIAA0040 MISSION shRNA Lentiviral Transduction Particles
KIAA0040
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1312s1c1
Sequence:CCGGCCTTGCCAGATTCAGACACATCTCGAGATGTGTCTGAATCTGGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014656.1-3108s1c1
Sequence:CCGGCCGGGACCATACAAGTAACATCTCGAGATGTTACTTGTATGGTCCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1011s1c1
Sequence:CCGGCGTGGACAATTCTTGGATACTCTCGAGAGTATCCAAGAATTGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1235s1c1
Sequence:CCGGCATCAAATGGTCATTGGCTATCTCGAGATAGCCAATGACCATTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014656.1-1273s1c1
Sequence:CCGGGTACATTATCTACAGTCACAACTCGAGTTGTGACTGTAGATAATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014656.2-841s21c1
Sequence:CCGGCATCACTGCCTGTTTAGTTAGCTCGAGCTAACTAAACAGGCAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014656.2-661s21c1
Sequence:CCGGTGCCACTCTTGGTGATCATCACTCGAGTGATGATCACCAAGAGTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014656.2-953s21c1
Sequence:CCGGCATGTCCACAGAGTAACTACTCTCGAGAGTAGTTACTCTGTGGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)