EMAIL THIS PAGE TO A FRIEND

KIAA0100

KIAA0100

60 Gene Product Result for
Synonyms: BCOX BCOX1 CT101
Gene ID:
chicken(417573) KIAA0100
domestic cat(101085330) KIAA0100 ortholog
cow(517133) KIAA0100 ortholog
dog(480625) KIAA0100 ortholog
domestic guinea pig(100725028) KIAA0100 ortholog
naked mole-rat(101711720) KIAA0100 ortholog
sheep(101105928) KIAA0100 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014680 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050471 MISSION® esiRNA esiRNA human KIAA0100 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014680 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048280 predicted 1711
2 SASI_Hs01_00048281 predicted 4439
3 SASI_Hs01_00048282 predicted 4431
4 SASI_Hs02_00346039 predicted 1793
5 SASI_Hs01_00048283 predicted 4497
6 SASI_Hs01_00048285 predicted 2488
7 SASI_Hs01_00048286 predicted 5395
8 SASI_Hs02_00346040 predicted 3960
9 SASI_Hs01_00048287 predicted 5406
10 SASI_Hs01_00048288 predicted 3128
11 SASI_Hs01_00048284 predicted 1936
12 SASI_Hs01_00048289 predicted 4220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014680
VALIDATED
KIAA0100 MISSION shRNA Bacterial Glycerol Stock
KIAA0100
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-1716s21c1
Sequence:CCGGCCAATGTCTGTCTCGTATCTTCTCGAGAAGATACGAGACAGACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-2697s21c1
Sequence:CCGGCCCACCTGATCTACTCTTAAACTCGAGTTTAAGAGTAGATCAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-1370s21c1
Sequence:CCGGCCATCTCCAATGTCAACATTTCTCGAGAAATGTTGACATTGGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014680.2-7101s21c1
Sequence:CCGGGTCCTGATCAAGTGTGATAAACTCGAGTTTATCACACTTGATCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-3348s21c1
Sequence:CCGGCCATGACTTTCACTCGGAAATCTCGAGATTTCCGAGTGAAAGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-1716s1c1
Sequence:CCGGCCAATGTCTGTCTCGTATCTTCTCGAGAAGATACGAGACAGACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014680.2-4797s1c1
Sequence:CCGGCCAGACGGATGACATATACAACTCGAGTTGTATATGTCATCCGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014680.2-7285s1c1
Sequence:CCGGCCAGTCTCTGTGCTAAGTTCACTCGAGTGAACTTAGCACAGAGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-7101s1c1
Sequence:CCGGGTCCTGATCAAGTGTGATAAACTCGAGTTTATCACACTTGATCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-3348s1c1
Sequence:CCGGCCATGACTTTCACTCGGAAATCTCGAGATTTCCGAGTGAAAGTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-2697s1c1
Sequence:CCGGCCCACCTGATCTACTCTTAAACTCGAGTTTAAGAGTAGATCAGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-1370s1c1
Sequence:CCGGCCATCTCCAATGTCAACATTTCTCGAGAAATGTTGACATTGGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014680
VALIDATED
KIAA0100 MISSION shRNA shRNA Plasmid DNA
KIAA0100
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-1716s21c1
Sequence:CCGGCCAATGTCTGTCTCGTATCTTCTCGAGAAGATACGAGACAGACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-2697s21c1
Sequence:CCGGCCCACCTGATCTACTCTTAAACTCGAGTTTAAGAGTAGATCAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-1370s21c1
Sequence:CCGGCCATCTCCAATGTCAACATTTCTCGAGAAATGTTGACATTGGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014680.2-7101s21c1
Sequence:CCGGGTCCTGATCAAGTGTGATAAACTCGAGTTTATCACACTTGATCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-3348s21c1
Sequence:CCGGCCATGACTTTCACTCGGAAATCTCGAGATTTCCGAGTGAAAGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-1716s1c1
Sequence:CCGGCCAATGTCTGTCTCGTATCTTCTCGAGAAGATACGAGACAGACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014680.2-4797s1c1
Sequence:CCGGCCAGACGGATGACATATACAACTCGAGTTGTATATGTCATCCGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014680.2-7285s1c1
Sequence:CCGGCCAGTCTCTGTGCTAAGTTCACTCGAGTGAACTTAGCACAGAGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-7101s1c1
Sequence:CCGGGTCCTGATCAAGTGTGATAAACTCGAGTTTATCACACTTGATCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-3348s1c1
Sequence:CCGGCCATGACTTTCACTCGGAAATCTCGAGATTTCCGAGTGAAAGTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-2697s1c1
Sequence:CCGGCCCACCTGATCTACTCTTAAACTCGAGTTTAAGAGTAGATCAGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-1370s1c1
Sequence:CCGGCCATCTCCAATGTCAACATTTCTCGAGAAATGTTGACATTGGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014680
VALIDATED
KIAA0100 MISSION shRNA Lentiviral Transduction Particles
KIAA0100
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-1716s21c1
Sequence:CCGGCCAATGTCTGTCTCGTATCTTCTCGAGAAGATACGAGACAGACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-2697s21c1
Sequence:CCGGCCCACCTGATCTACTCTTAAACTCGAGTTTAAGAGTAGATCAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-1370s21c1
Sequence:CCGGCCATCTCCAATGTCAACATTTCTCGAGAAATGTTGACATTGGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014680.2-7101s21c1
Sequence:CCGGGTCCTGATCAAGTGTGATAAACTCGAGTTTATCACACTTGATCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014680.2-3348s21c1
Sequence:CCGGCCATGACTTTCACTCGGAAATCTCGAGATTTCCGAGTGAAAGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-1716s1c1
Sequence:CCGGCCAATGTCTGTCTCGTATCTTCTCGAGAAGATACGAGACAGACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014680.2-4797s1c1
Sequence:CCGGCCAGACGGATGACATATACAACTCGAGTTGTATATGTCATCCGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014680.2-7285s1c1
Sequence:CCGGCCAGTCTCTGTGCTAAGTTCACTCGAGTGAACTTAGCACAGAGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-7101s1c1
Sequence:CCGGGTCCTGATCAAGTGTGATAAACTCGAGTTTATCACACTTGATCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-3348s1c1
Sequence:CCGGCCATGACTTTCACTCGGAAATCTCGAGATTTCCGAGTGAAAGTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-2697s1c1
Sequence:CCGGCCCACCTGATCTACTCTTAAACTCGAGTTTAAGAGTAGATCAGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014680.2-1370s1c1
Sequence:CCGGCCATCTCCAATGTCAACATTTCTCGAGAAATGTTGACATTGGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)