EMAIL THIS PAGE TO A FRIEND

KIAA0101

KIAA0101

69 Gene Product Result for
Synonyms: NS5ATP9 OEATC OEATC-1 OEATC1 PAF PAF15 p15(PAF) p15/PAF p15PAF
UniProtKB ID: Q15004, A6NNU5, A8K3Y3, G9G694, G9G696
Gene ID:
sheep(101108753) KIAA0101 ortholog
domestic guinea pig(100728024) KIAA0101 ortholog
naked mole-rat(101704489) KIAA0101 ortholog
chicken(101748248) KIAA0101 ortholog
chicken(101668132) KIAA0101 ortholog
cow(540737) KIAA0101 ortholog
domestic cat(101087323) KIAA0101 ortholog
dog(610710) KIAA0101 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014736 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107801 MISSION® esiRNA esiRNA human KIAA0101 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029989 Rosetta Predictions human pricing
NM_014736 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307584 predicted 591
2 SASI_Hs01_00222529 predicted 488
3 SASI_Hs01_00222530 predicted 536
4 SASI_Hs01_00222531 predicted 557
5 SASI_Hs01_00222532 predicted 484
6 SASI_Hs01_00222533 predicted 569
7 SASI_Hs02_00307585 predicted 661
8 SASI_Hs01_00222534 predicted 578
9 SASI_Hs01_00222535 predicted 586
10 SASI_Hs02_00307586 predicted 535
11 SASI_Hs01_00222526 predicted 580
12 SASI_Hs01_00222527 predicted 465
13 SASI_Hs01_00222528 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346185 predicted 749
2 SASI_Hs01_00016248 predicted 654
3 SASI_Hs01_00016249 predicted 704
4 SASI_Hs01_00016250 predicted 728
5 SASI_Hs01_00016251 predicted 648
6 SASI_Hs01_00016252 predicted 731
7 SASI_Hs02_00346186 predicted 825
8 SASI_Hs01_00016253 predicted 743
9 SASI_Hs01_00016254 predicted 749
10 SASI_Hs02_00346187 predicted 697
11 SASI_Hs01_00016245 predicted 739
12 SASI_Hs01_00016246 predicted 633
13 SASI_Hs01_00016247 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014736
VALIDATED
KIAA0101 MISSION shRNA Bacterial Glycerol Stock
KIAA0101
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014736.4-1029s21c1
Sequence:CCGGCGGTTGATAATGCCTCTACAACTCGAGTTGTAGAGGCATTATCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-509s21c1
Sequence:CCGGCCTGGTATTCTAGAATGTAAACTCGAGTTTACATTCTAGAATACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-237s21c1
Sequence:CCGGGACATCAGTTTCATCGAGGAACTCGAGTTCCTCGATGAAACTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-294s1c1
Sequence:CCGGGAGAATCAGATTCCTGAAGAGCTCGAGCTCTTCAGGAATCTGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-362s1c1
Sequence:CCGGGCAACCTGATCACACAAATGACTCGAGTCATTTGTGTGATCAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-366s1c1
Sequence:CCGGCCTGATCACACAAATGATGAACTCGAGTTCATCATTTGTGTGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-484s1c1
Sequence:CCGGGCTTTGTTGAACAGGCATTTACTCGAGTAAATGCCTGTTCAACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-435s21c1
Sequence:CCGGGCAACCTGATCACACAAATGACTCGAGTCATTTGTGTGATCAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-351s1c1
Sequence:CCGGGCATGTCCTTTGCAACCTGATCTCGAGATCAGGTTGCAAAGGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-436s1c1
Sequence:CCGGCCTGGTATTCTAGAATGTAAACTCGAGTTTACATTCTAGAATACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014736.4-557s21c1
Sequence:CCGGGCTTTGTTGAACAGGCATTTACTCGAGTAAATGCCTGTTCAACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-164s1c1
Sequence:CCGGGACATCAGTTTCATCGAGGAACTCGAGTTCCTCGATGAAACTGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014736.3-956s1c1
Sequence:CCGGCGGTTGATAATGCCTCTACAACTCGAGTTGTAGAGGCATTATCAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014736
VALIDATED
KIAA0101 MISSION shRNA shRNA Plasmid DNA
KIAA0101
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014736.4-1029s21c1
Sequence:CCGGCGGTTGATAATGCCTCTACAACTCGAGTTGTAGAGGCATTATCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-509s21c1
Sequence:CCGGCCTGGTATTCTAGAATGTAAACTCGAGTTTACATTCTAGAATACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-237s21c1
Sequence:CCGGGACATCAGTTTCATCGAGGAACTCGAGTTCCTCGATGAAACTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-294s1c1
Sequence:CCGGGAGAATCAGATTCCTGAAGAGCTCGAGCTCTTCAGGAATCTGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-362s1c1
Sequence:CCGGGCAACCTGATCACACAAATGACTCGAGTCATTTGTGTGATCAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-366s1c1
Sequence:CCGGCCTGATCACACAAATGATGAACTCGAGTTCATCATTTGTGTGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-484s1c1
Sequence:CCGGGCTTTGTTGAACAGGCATTTACTCGAGTAAATGCCTGTTCAACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-435s21c1
Sequence:CCGGGCAACCTGATCACACAAATGACTCGAGTCATTTGTGTGATCAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-351s1c1
Sequence:CCGGGCATGTCCTTTGCAACCTGATCTCGAGATCAGGTTGCAAAGGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-436s1c1
Sequence:CCGGCCTGGTATTCTAGAATGTAAACTCGAGTTTACATTCTAGAATACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014736.4-557s21c1
Sequence:CCGGGCTTTGTTGAACAGGCATTTACTCGAGTAAATGCCTGTTCAACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-164s1c1
Sequence:CCGGGACATCAGTTTCATCGAGGAACTCGAGTTCCTCGATGAAACTGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014736.3-956s1c1
Sequence:CCGGCGGTTGATAATGCCTCTACAACTCGAGTTGTAGAGGCATTATCAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014736
VALIDATED
KIAA0101 MISSION shRNA Lentiviral Transduction Particles
KIAA0101
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014736.4-1029s21c1
Sequence:CCGGCGGTTGATAATGCCTCTACAACTCGAGTTGTAGAGGCATTATCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-509s21c1
Sequence:CCGGCCTGGTATTCTAGAATGTAAACTCGAGTTTACATTCTAGAATACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-237s21c1
Sequence:CCGGGACATCAGTTTCATCGAGGAACTCGAGTTCCTCGATGAAACTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-294s1c1
Sequence:CCGGGAGAATCAGATTCCTGAAGAGCTCGAGCTCTTCAGGAATCTGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-362s1c1
Sequence:CCGGGCAACCTGATCACACAAATGACTCGAGTCATTTGTGTGATCAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-366s1c1
Sequence:CCGGCCTGATCACACAAATGATGAACTCGAGTTCATCATTTGTGTGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-484s1c1
Sequence:CCGGGCTTTGTTGAACAGGCATTTACTCGAGTAAATGCCTGTTCAACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014736.4-435s21c1
Sequence:CCGGGCAACCTGATCACACAAATGACTCGAGTCATTTGTGTGATCAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014736.3-351s1c1
Sequence:CCGGGCATGTCCTTTGCAACCTGATCTCGAGATCAGGTTGCAAAGGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-436s1c1
Sequence:CCGGCCTGGTATTCTAGAATGTAAACTCGAGTTTACATTCTAGAATACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014736.4-557s21c1
Sequence:CCGGGCTTTGTTGAACAGGCATTTACTCGAGTAAATGCCTGTTCAACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014736.3-164s1c1
Sequence:CCGGGACATCAGTTTCATCGAGGAACTCGAGTTCCTCGATGAAACTGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014736.3-956s1c1
Sequence:CCGGCGGTTGATAATGCCTCTACAACTCGAGTTGTAGAGGCATTATCAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)