EMAIL THIS PAGE TO A FRIEND

KIAA0125

KIAA0125

30 Gene Product Result for
Synonyms: C14orf110 FAM30A
Species: Human KIAA0125(9834)
UniProtKB ID: Q9NZY2, C9J8W9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014792 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014792 Rosetta Predictions human pricing
XR_039974 Rosetta Predictions human pricing
XR_039975 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036946 predicted 4348
2 SASI_Hs01_00036947 predicted 6672
3 SASI_Hs01_00036948 predicted 6659
4 SASI_Hs01_00036949 predicted 7642
5 SASI_Hs01_00036950 predicted 6604
6 SASI_Hs01_00036951 predicted 7298
7 SASI_Hs01_00036952 predicted 7570
8 SASI_Hs01_00036953 predicted 7822
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514771 predicted 420
2 SASI_Hs02_00514772 predicted 334
3 SASI_Hs02_00514773 predicted 325
4 SASI_Hs02_00514774 predicted 331
5 SASI_Hs02_00514775 predicted 375
6 SASI_Hs02_00514776 predicted 248
7 SASI_Hs02_00514777 predicted 378
8 SASI_Hs02_00514778 predicted 215
9 SASI_Hs02_00514779 predicted 371
10 SASI_Hs02_00514780 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514781 predicted 421
2 SASI_Hs02_00514782 predicted 329
3 SASI_Hs02_00514783 predicted 327
4 SASI_Hs02_00514784 predicted 327
5 SASI_Hs02_00514785 predicted 379
6 SASI_Hs02_00514786 predicted 245
7 SASI_Hs02_00514787 predicted 379
8 SASI_Hs02_00514788 predicted 216
9 SASI_Hs02_00514789 predicted 378
10 SASI_Hs02_00514790 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014792
KIAA0125 MISSION shRNA Bacterial Glycerol Stock
KIAA0125
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000168872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-6259s1c1
Sequence:CCGGCCCACAATATAGACAGGCATTCTCGAGAATGCCTGTCTATATTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-7638s1c1
Sequence:CCGGCCCGTGTAAGAACACTTCTTACTCGAGTAAGAAGTGTTCTTACACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167127    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-4352s1c1
Sequence:CCGGCCTTTCGTATTTGTTGAGAAACTCGAGTTTCTCAACAAATACGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014792
KIAA0125 MISSION shRNA shRNA Plasmid DNA
KIAA0125
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000168872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-6259s1c1
Sequence:CCGGCCCACAATATAGACAGGCATTCTCGAGAATGCCTGTCTATATTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-7638s1c1
Sequence:CCGGCCCGTGTAAGAACACTTCTTACTCGAGTAAGAAGTGTTCTTACACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167127    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-4352s1c1
Sequence:CCGGCCTTTCGTATTTGTTGAGAAACTCGAGTTTCTCAACAAATACGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014792
KIAA0125 MISSION shRNA Lentiviral Transduction Particles
KIAA0125
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000168872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-6259s1c1
Sequence:CCGGCCCACAATATAGACAGGCATTCTCGAGAATGCCTGTCTATATTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-7638s1c1
Sequence:CCGGCCCGTGTAAGAACACTTCTTACTCGAGTAAGAAGTGTTCTTACACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167127    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014792.2-4352s1c1
Sequence:CCGGCCTTTCGTATTTGTTGAGAAACTCGAGTTTCTCAACAAATACGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)