EMAIL THIS PAGE TO A FRIEND

KIAA0196

KIAA0196

50 Gene Product Result for
Synonyms: SPG8
UniProtKB ID: Q12768, A8K4R7, Q3KQX5, Q8TBQ2
Gene ID:
Human(9897) Summary: This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
domestic guinea pig(100725103) KIAA0196 ortholog
naked mole-rat(101708947) KIAA0196 ortholog
sheep(101104670) KIAA0196 ortholog
chicken(420334) KIAA0196
dog(475095) KIAA0196 ortholog
cow(508040) KIAA0196 ortholog
domestic cat(101090992) KIAA0196 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014846 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014846 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346406 predicted 1488
2 SASI_Hs01_00210976 predicted 1521
3 SASI_Hs02_00346407 predicted 1919
4 SASI_Hs01_00210979 predicted 3302
5 SASI_Hs01_00210981 predicted 1537
6 SASI_Hs01_00210982 predicted 758
7 SASI_Hs01_00210983 predicted 2024
8 SASI_Hs02_00346408 predicted 1597
9 SASI_Hs01_00210984 predicted 892
10 SASI_Hs02_00346409 predicted 2337
11 SASI_Hs01_00210977 predicted 1799
12 SASI_Hs01_00210978 predicted 2787
13 SASI_Hs01_00210980 predicted 1099
14 SASI_Hs01_00210985 predicted 3544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014846
VALIDATED
KIAA0196 MISSION shRNA Bacterial Glycerol Stock
KIAA0196
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014846.2-3012s1c1
Sequence:CCGGGCTGCTCTGGAGAATCTCAATCTCGAGATTGAGATTCTCCAGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014846.2-117s1c1
Sequence:CCGGCAAGCAATCCTAAGGATTGTTCTCGAGAACAATCCTTAGGATTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014846.2-851s1c1
Sequence:CCGGGCTGTACGTGATTCTCTACTTCTCGAGAAGTAGAGAATCACGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-575s1c1
Sequence:CCGGGCTGGTTTCTTACTACCGATACTCGAGTATCGGTAGTAAGAAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-615s1c1
Sequence:CCGGGCTGATTCAAATATGGACGATCTCGAGATCGTCCATATTTGAATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014846.2-2606s1c1
Sequence:CCGGGCTGAACACTTGGTATGATATCTCGAGATATCATACCAAGTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014846.2-3637s1c1
Sequence:CCGGGAAACTCAGTTGCTCATACAACTCGAGTTGTATGAGCAACTGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-2455s1c1
Sequence:CCGGCGAAGATTCAAGATTGGCAAACTCGAGTTTGCCAATCTTGAATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014846.3-3261s21c1
Sequence:CCGGGCTGCTCTGGAGAATCTCAATCTCGAGATTGAGATTCTCCAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-864s21c1
Sequence:CCGGGCTGATTCAAATATGGACGATCTCGAGATCGTCCATATTTGAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-2855s21c1
Sequence:CCGGGCTGAACACTTGGTATGATATCTCGAGATATCATACCAAGTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-2704s21c1
Sequence:CCGGCGAAGATTCAAGATTGGCAAACTCGAGTTTGCCAATCTTGAATCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014846
VALIDATED
KIAA0196 MISSION shRNA shRNA Plasmid DNA
KIAA0196
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014846.2-3012s1c1
Sequence:CCGGGCTGCTCTGGAGAATCTCAATCTCGAGATTGAGATTCTCCAGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014846.2-117s1c1
Sequence:CCGGCAAGCAATCCTAAGGATTGTTCTCGAGAACAATCCTTAGGATTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014846.2-851s1c1
Sequence:CCGGGCTGTACGTGATTCTCTACTTCTCGAGAAGTAGAGAATCACGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-575s1c1
Sequence:CCGGGCTGGTTTCTTACTACCGATACTCGAGTATCGGTAGTAAGAAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-615s1c1
Sequence:CCGGGCTGATTCAAATATGGACGATCTCGAGATCGTCCATATTTGAATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014846.2-2606s1c1
Sequence:CCGGGCTGAACACTTGGTATGATATCTCGAGATATCATACCAAGTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014846.2-3637s1c1
Sequence:CCGGGAAACTCAGTTGCTCATACAACTCGAGTTGTATGAGCAACTGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-2455s1c1
Sequence:CCGGCGAAGATTCAAGATTGGCAAACTCGAGTTTGCCAATCTTGAATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014846.3-3261s21c1
Sequence:CCGGGCTGCTCTGGAGAATCTCAATCTCGAGATTGAGATTCTCCAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-864s21c1
Sequence:CCGGGCTGATTCAAATATGGACGATCTCGAGATCGTCCATATTTGAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-2855s21c1
Sequence:CCGGGCTGAACACTTGGTATGATATCTCGAGATATCATACCAAGTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-2704s21c1
Sequence:CCGGCGAAGATTCAAGATTGGCAAACTCGAGTTTGCCAATCTTGAATCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014846
VALIDATED
KIAA0196 MISSION shRNA Lentiviral Transduction Particles
KIAA0196
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014846.2-3012s1c1
Sequence:CCGGGCTGCTCTGGAGAATCTCAATCTCGAGATTGAGATTCTCCAGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014846.2-117s1c1
Sequence:CCGGCAAGCAATCCTAAGGATTGTTCTCGAGAACAATCCTTAGGATTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014846.2-851s1c1
Sequence:CCGGGCTGTACGTGATTCTCTACTTCTCGAGAAGTAGAGAATCACGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-575s1c1
Sequence:CCGGGCTGGTTTCTTACTACCGATACTCGAGTATCGGTAGTAAGAAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-615s1c1
Sequence:CCGGGCTGATTCAAATATGGACGATCTCGAGATCGTCCATATTTGAATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014846.2-2606s1c1
Sequence:CCGGGCTGAACACTTGGTATGATATCTCGAGATATCATACCAAGTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014846.2-3637s1c1
Sequence:CCGGGAAACTCAGTTGCTCATACAACTCGAGTTGTATGAGCAACTGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014846.2-2455s1c1
Sequence:CCGGCGAAGATTCAAGATTGGCAAACTCGAGTTTGCCAATCTTGAATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014846.3-3261s21c1
Sequence:CCGGGCTGCTCTGGAGAATCTCAATCTCGAGATTGAGATTCTCCAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-864s21c1
Sequence:CCGGGCTGATTCAAATATGGACGATCTCGAGATCGTCCATATTTGAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-2855s21c1
Sequence:CCGGGCTGAACACTTGGTATGATATCTCGAGATATCATACCAAGTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014846.3-2704s21c1
Sequence:CCGGCGAAGATTCAAGATTGGCAAACTCGAGTTTGCCAATCTTGAATCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)