EMAIL THIS PAGE TO A FRIEND

KIAA0226

KIAA0226

73 Gene Product Result for
Synonyms: RUBICON
UniProtKB ID: Q92622, Q96CK5
Gene ID:
chicken(424920) KIAA0226
cow(508354) KIAA0226 ortholog
domestic cat(101098570) KIAA0226 ortholog
dog(609247) KIAA0226 ortholog
sheep(101122159) KIAA0226 ortholog
domestic guinea pig(100724599) KIAA0226 ortholog
naked mole-rat(101699241) KIAA0226 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_032901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_032901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_032901 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080121 MISSION® esiRNA esiRNA human KIAA0226 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014687 Rosetta Predictions human pricing
XM_032901 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346051 predicted 2545
2 SASI_Hs02_00346052 predicted 2862
3 SASI_Hs02_00346053 predicted 1447
4 SASI_Hs02_00346054 predicted 1435
5 SASI_Hs02_00346055 predicted 374
6 SASI_Hs02_00346056 predicted 2364
7 SASI_Hs02_00346057 predicted 1484
8 SASI_Hs02_00346058 predicted 1664
9 SASI_Hs02_00346059 predicted 909
10 SASI_Hs02_00346060 predicted 1710
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_032901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250500 predicted 1075
2 SASI_Hs01_00250501 predicted 1461
3 SASI_Hs01_00250502 predicted 1214
4 SASI_Hs01_00250503 predicted 891
5 SASI_Hs01_00250504 predicted 617
6 SASI_Hs01_00250505 predicted 664
7 SASI_Hs01_00250506 predicted 1146
8 SASI_Hs01_00250507 predicted 1131
9 SASI_Hs01_00250508 predicted 653
10 SASI_Hs01_00250509 predicted 1386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014687
KIAA0226 MISSION shRNA Bacterial Glycerol Stock
KIAA0226
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-2927s21c1
Sequence:CCGGGTAAAGCGTGTTACCATAAAGCTCGAGCTTTATGGTAACACGCTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-422s21c1
Sequence:CCGGATTACTGGCAGTTCGTGAAAGCTCGAGCTTTCACGAACTGCCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-317s21c1
Sequence:CCGGCCAACGTCTGGTCTAAGTATGCTCGAGCATACTTAGACCAGACGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-258s21c1
Sequence:CCGGCTGGCAGTTGCTGGGTAATTTCTCGAGAAATTACCCAGCAACTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014687.1-3446s21c1
Sequence:CCGGCCTGCATGTCAGGTATCATTTCTCGAGAAATGATACCTGACATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014687
KIAA0226 MISSION shRNA shRNA Plasmid DNA
KIAA0226
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-2927s21c1
Sequence:CCGGGTAAAGCGTGTTACCATAAAGCTCGAGCTTTATGGTAACACGCTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-422s21c1
Sequence:CCGGATTACTGGCAGTTCGTGAAAGCTCGAGCTTTCACGAACTGCCAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-317s21c1
Sequence:CCGGCCAACGTCTGGTCTAAGTATGCTCGAGCATACTTAGACCAGACGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-258s21c1
Sequence:CCGGCTGGCAGTTGCTGGGTAATTTCTCGAGAAATTACCCAGCAACTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014687.1-3446s21c1
Sequence:CCGGCCTGCATGTCAGGTATCATTTCTCGAGAAATGATACCTGACATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014687
KIAA0226 MISSION shRNA Lentiviral Transduction Particles
KIAA0226
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-2927s21c1
Sequence:CCGGGTAAAGCGTGTTACCATAAAGCTCGAGCTTTATGGTAACACGCTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-422s21c1
Sequence:CCGGATTACTGGCAGTTCGTGAAAGCTCGAGCTTTCACGAACTGCCAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-317s21c1
Sequence:CCGGCCAACGTCTGGTCTAAGTATGCTCGAGCATACTTAGACCAGACGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014687.1-258s21c1
Sequence:CCGGCTGGCAGTTGCTGGGTAATTTCTCGAGAAATTACCCAGCAACTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014687.1-3446s21c1
Sequence:CCGGCCTGCATGTCAGGTATCATTTCTCGAGAAATGATACCTGACATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_032901
VALIDATED
KIAA0226 MISSION shRNA Bacterial Glycerol Stock
KIAA0226
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_032901.7-5704s1c1
Sequence:CCGGCCTTCCAAATACCCAGTTATTCTCGAGAATAACTGGGTATTTGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-1743s1c1
Sequence:CCGGCGAGCTAATGAAGTGCAACATCTCGAGATGTTGCACTTCATTAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032901.7-60s1c1
Sequence:CCGGCGGTGTTCACTACCCTAATAACTCGAGTTATTAGGGTAGTGAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-1263s1c1
Sequence:CCGGCGAGAGCAGCAGTTCCAATTTCTCGAGAAATTGGAACTGCTGCTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-2953s1c1
Sequence:CCGGCGGACCTGTGAAGAGTGTAAACTCGAGTTTACACTCTTCACAGGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_032901
VALIDATED
KIAA0226 MISSION shRNA shRNA Plasmid DNA
KIAA0226
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_032901.7-5704s1c1
Sequence:CCGGCCTTCCAAATACCCAGTTATTCTCGAGAATAACTGGGTATTTGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-1743s1c1
Sequence:CCGGCGAGCTAATGAAGTGCAACATCTCGAGATGTTGCACTTCATTAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032901.7-60s1c1
Sequence:CCGGCGGTGTTCACTACCCTAATAACTCGAGTTATTAGGGTAGTGAACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-1263s1c1
Sequence:CCGGCGAGAGCAGCAGTTCCAATTTCTCGAGAAATTGGAACTGCTGCTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-2953s1c1
Sequence:CCGGCGGACCTGTGAAGAGTGTAAACTCGAGTTTACACTCTTCACAGGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_032901
VALIDATED
KIAA0226 MISSION shRNA Lentiviral Transduction Particles
KIAA0226
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_032901.7-5704s1c1
Sequence:CCGGCCTTCCAAATACCCAGTTATTCTCGAGAATAACTGGGTATTTGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-1743s1c1
Sequence:CCGGCGAGCTAATGAAGTGCAACATCTCGAGATGTTGCACTTCATTAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_032901.7-60s1c1
Sequence:CCGGCGGTGTTCACTACCCTAATAACTCGAGTTATTAGGGTAGTGAACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-1263s1c1
Sequence:CCGGCGAGAGCAGCAGTTCCAATTTCTCGAGAAATTGGAACTGCTGCTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:XM_032901.7-2953s1c1
Sequence:CCGGCGGACCTGTGAAGAGTGTAAACTCGAGTTTACACTCTTCACAGGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)