EMAIL THIS PAGE TO A FRIEND

KIAA0232

KIAA0232

136 Gene Product Result for
UniProtKB ID: Q92628, A7E2D2
Gene ID:
chicken(422860) KIAA0232
domestic cat(101099549) KIAA0232 ortholog
cow(514704) KIAA0232 ortholog
dog(610307) KIAA0232 ortholog
sheep(101108655) KIAA0232 ortholog
domestic guinea pig(100715550) KIAA0232 ortholog
naked mole-rat(101719941) KIAA0232 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014743 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008881 MISSION® esiRNA esiRNA targeting human KIAA0232 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100590 Rosetta Predictions human pricing
NM_014743 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322164 predicted 3635
2 SASI_Hs02_00322165 predicted 1783
3 SASI_Hs02_00322166 predicted 2204
4 SASI_Hs02_00322167 predicted 3276
5 SASI_Hs02_00322168 predicted 1633
6 SASI_Hs02_00322169 predicted 1763
7 SASI_Hs02_00322170 predicted 4331
8 SASI_Hs02_00322171 predicted 1883
9 SASI_Hs02_00322172 predicted 2065
10 SASI_Hs02_00322173 predicted 3517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181682 predicted 3718
2 SASI_Hs01_00181683 predicted 1873
3 SASI_Hs01_00181684 predicted 2293
4 SASI_Hs01_00181686 predicted 3358
5 SASI_Hs01_00181687 predicted 1716
6 SASI_Hs02_00346206 predicted 1845
7 SASI_Hs02_00346207 predicted 4421
8 SASI_Hs01_00181688 predicted 1966
9 SASI_Hs01_00181689 predicted 2150
10 SASI_Hs02_00346208 predicted 3602
11 SASI_Hs01_00181685 predicted 2104
12 SASI_Hs01_00181690 predicted 1735
13 SASI_Hs01_00181691 predicted 4042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014743
VALIDATED
KIAA0232 MISSION shRNA Bacterial Glycerol Stock
KIAA0232
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014743.1-6043s1c1
Sequence:CCGGGCAGGCAGTAAACACACATATCTCGAGATATGTGTGTTTACTGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014743.1-3342s1c1
Sequence:CCGGGCTTCTGATGTTGTGACGATACTCGAGTATCGTCACAACATCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-2100s1c1
Sequence:CCGGGCAGAATGTTGCATAGTGTTACTCGAGTAACACTATGCAACATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-3552s1c1
Sequence:CCGGCCTGGACTTGAATACTCATTTCTCGAGAAATGAGTATTCAAGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-3577s1c1
Sequence:CCGGCCTTTGACTTAAGCAATCCATCTCGAGATGGATTGCTTAAGTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014743.1-615s1c1
Sequence:CCGGGCCATGATTTACACTCGGTATCTCGAGATACCGAGTGTAAATCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014743.1-6948s1c1
Sequence:CCGGCGTGGTTGTATTGTTCTGATTCTCGAGAATCAGAACAATACAACCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3177s21c1
Sequence:CCGGACGTGGATGGTGGTGATTATACTCGAGTATAATCACCACCATCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-2108s21c1
Sequence:CCGGGCAGAATGTTGCATAGTGTTACTCGAGTAACACTATGCAACATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3560s21c1
Sequence:CCGGCCTGGACTTGAATACTCATTTCTCGAGAAATGAGTATTCAAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014743.2-4711s21c1
Sequence:CCGGAGTGAGACCTGTTAATCTAAACTCGAGTTTAGATTAACAGGTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3585s21c1
Sequence:CCGGCCTTTGACTTAAGCAATCCATCTCGAGATGGATTGCTTAAGTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014743
VALIDATED
KIAA0232 MISSION shRNA shRNA Plasmid DNA
KIAA0232
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014743.1-6043s1c1
Sequence:CCGGGCAGGCAGTAAACACACATATCTCGAGATATGTGTGTTTACTGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014743.1-3342s1c1
Sequence:CCGGGCTTCTGATGTTGTGACGATACTCGAGTATCGTCACAACATCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-2100s1c1
Sequence:CCGGGCAGAATGTTGCATAGTGTTACTCGAGTAACACTATGCAACATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-3552s1c1
Sequence:CCGGCCTGGACTTGAATACTCATTTCTCGAGAAATGAGTATTCAAGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-3577s1c1
Sequence:CCGGCCTTTGACTTAAGCAATCCATCTCGAGATGGATTGCTTAAGTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014743.1-615s1c1
Sequence:CCGGGCCATGATTTACACTCGGTATCTCGAGATACCGAGTGTAAATCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014743.1-6948s1c1
Sequence:CCGGCGTGGTTGTATTGTTCTGATTCTCGAGAATCAGAACAATACAACCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3177s21c1
Sequence:CCGGACGTGGATGGTGGTGATTATACTCGAGTATAATCACCACCATCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-2108s21c1
Sequence:CCGGGCAGAATGTTGCATAGTGTTACTCGAGTAACACTATGCAACATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3560s21c1
Sequence:CCGGCCTGGACTTGAATACTCATTTCTCGAGAAATGAGTATTCAAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014743.2-4711s21c1
Sequence:CCGGAGTGAGACCTGTTAATCTAAACTCGAGTTTAGATTAACAGGTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3585s21c1
Sequence:CCGGCCTTTGACTTAAGCAATCCATCTCGAGATGGATTGCTTAAGTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014743
VALIDATED
KIAA0232 MISSION shRNA Lentiviral Transduction Particles
KIAA0232
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168707    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014743.1-6043s1c1
Sequence:CCGGGCAGGCAGTAAACACACATATCTCGAGATATGTGTGTTTACTGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014743.1-3342s1c1
Sequence:CCGGGCTTCTGATGTTGTGACGATACTCGAGTATCGTCACAACATCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-2100s1c1
Sequence:CCGGGCAGAATGTTGCATAGTGTTACTCGAGTAACACTATGCAACATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-3552s1c1
Sequence:CCGGCCTGGACTTGAATACTCATTTCTCGAGAAATGAGTATTCAAGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014743.1-3577s1c1
Sequence:CCGGCCTTTGACTTAAGCAATCCATCTCGAGATGGATTGCTTAAGTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014743.1-615s1c1
Sequence:CCGGGCCATGATTTACACTCGGTATCTCGAGATACCGAGTGTAAATCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014743.1-6948s1c1
Sequence:CCGGCGTGGTTGTATTGTTCTGATTCTCGAGAATCAGAACAATACAACCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3177s21c1
Sequence:CCGGACGTGGATGGTGGTGATTATACTCGAGTATAATCACCACCATCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-2108s21c1
Sequence:CCGGGCAGAATGTTGCATAGTGTTACTCGAGTAACACTATGCAACATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3560s21c1
Sequence:CCGGCCTGGACTTGAATACTCATTTCTCGAGAAATGAGTATTCAAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014743.2-4711s21c1
Sequence:CCGGAGTGAGACCTGTTAATCTAAACTCGAGTTTAGATTAACAGGTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_014743.2-3585s21c1
Sequence:CCGGCCTTTGACTTAAGCAATCCATCTCGAGATGGATTGCTTAAGTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)