EMAIL THIS PAGE TO A FRIEND

KIAA0247

KIAA0247

91 Gene Product Result for
UniProtKB ID: Q92537
Gene ID:
chicken(423259) KIAA0247
domestic cat(101101140) KIAA0247 ortholog
cow(510837) KIAA0247 ortholog
dog(490752) KIAA0247 ortholog
sheep(101119480) KIAA0247 ortholog
domestic guinea pig(100723656) KIAA0247 ortholog
naked mole-rat(101704968) KIAA0247 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014734 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001861 MISSION® esiRNA esiRNA targeting human KIAA0247 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014734 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207903 predicted 540
2 SASI_Hs02_00346180 predicted 614
3 SASI_Hs01_00207904 predicted 1134
4 SASI_Hs01_00207905 predicted 521
5 SASI_Hs01_00207906 predicted 1193
6 SASI_Hs02_00346181 predicted 1626
7 SASI_Hs01_00207907 predicted 839
8 SASI_Hs01_00207909 predicted 1292
9 SASI_Hs01_00207911 predicted 603
10 SASI_Hs01_00207912 predicted 1347
11 SASI_Hs01_00207908 predicted 1135
12 SASI_Hs01_00207910 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014734
VALIDATED
KIAA0247 MISSION shRNA Bacterial Glycerol Stock
KIAA0247
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-545s21c1
Sequence:CCGGTACATGTTGAAGGGCGATTACCTCGAGGTAATCGCCCTTCAACATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014734.2-1838s21c1
Sequence:CCGGGTTGACCCTGGTGGCATATTTCTCGAGAAATATGCCACCAGGGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-5126s1c1
Sequence:CCGGCGCACCACTATGGAATCCTTTCTCGAGAAAGGATTCCATAGTGGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1139s1c1
Sequence:CCGGGATTCAGAGAACAGTGACATACTCGAGTATGTCACTGTTCTCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-840s21c1
Sequence:CCGGCATACGAGGAGGCTGTATATGCTCGAGCATATACAGCCTCCTCGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-616s21c1
Sequence:CCGGCTGCCGTCTCAACGAGGATAACTCGAGTTATCCTCGTTGAGACGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1113s1c1
Sequence:CCGGGCCAACTGGCACACAAAGAAACTCGAGTTTCTTTGTGTGCCAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1182s1c1
Sequence:CCGGCAGAGGAGTACACAGATGATACTCGAGTATCATCTGTGTACTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014734.2-1583s1c1
Sequence:CCGGGCTGTGTTTACTTGTGCCTTTCTCGAGAAAGGCACAAGTAAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014734
VALIDATED
KIAA0247 MISSION shRNA shRNA Plasmid DNA
KIAA0247
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-545s21c1
Sequence:CCGGTACATGTTGAAGGGCGATTACCTCGAGGTAATCGCCCTTCAACATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014734.2-1838s21c1
Sequence:CCGGGTTGACCCTGGTGGCATATTTCTCGAGAAATATGCCACCAGGGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-5126s1c1
Sequence:CCGGCGCACCACTATGGAATCCTTTCTCGAGAAAGGATTCCATAGTGGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1139s1c1
Sequence:CCGGGATTCAGAGAACAGTGACATACTCGAGTATGTCACTGTTCTCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-840s21c1
Sequence:CCGGCATACGAGGAGGCTGTATATGCTCGAGCATATACAGCCTCCTCGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-616s21c1
Sequence:CCGGCTGCCGTCTCAACGAGGATAACTCGAGTTATCCTCGTTGAGACGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1113s1c1
Sequence:CCGGGCCAACTGGCACACAAAGAAACTCGAGTTTCTTTGTGTGCCAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1182s1c1
Sequence:CCGGCAGAGGAGTACACAGATGATACTCGAGTATCATCTGTGTACTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014734.2-1583s1c1
Sequence:CCGGGCTGTGTTTACTTGTGCCTTTCTCGAGAAAGGCACAAGTAAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014734
VALIDATED
KIAA0247 MISSION shRNA Lentiviral Transduction Particles
KIAA0247
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-545s21c1
Sequence:CCGGTACATGTTGAAGGGCGATTACCTCGAGGTAATCGCCCTTCAACATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014734.2-1838s21c1
Sequence:CCGGGTTGACCCTGGTGGCATATTTCTCGAGAAATATGCCACCAGGGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-5126s1c1
Sequence:CCGGCGCACCACTATGGAATCCTTTCTCGAGAAAGGATTCCATAGTGGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1139s1c1
Sequence:CCGGGATTCAGAGAACAGTGACATACTCGAGTATGTCACTGTTCTCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-840s21c1
Sequence:CCGGCATACGAGGAGGCTGTATATGCTCGAGCATATACAGCCTCCTCGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014734.2-616s21c1
Sequence:CCGGCTGCCGTCTCAACGAGGATAACTCGAGTTATCCTCGTTGAGACGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1113s1c1
Sequence:CCGGGCCAACTGGCACACAAAGAAACTCGAGTTTCTTTGTGTGCCAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014734.2-1182s1c1
Sequence:CCGGCAGAGGAGTACACAGATGATACTCGAGTATCATCTGTGTACTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135409    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014734.2-1583s1c1
Sequence:CCGGGCTGTGTTTACTTGTGCCTTTCTCGAGAAAGGCACAAGTAAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)