EMAIL THIS PAGE TO A FRIEND

KIAA0319L

KIAA0319-like

46 Gene Product Result for
Gene ID:
Human(79932) Summary: This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
chicken(419634) KIAA0319-like
dog(482483) KIAA0319-like ortholog
cow(784489) KIAA0319-like ortholog
domestic cat(101085992) KIAA0319-like ortholog
domestic guinea pig(100715419) KIAA0319-like ortholog
naked mole-rat(101709856) KIAA0319-like ortholog
sheep(101109922) KIAA0319-like ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024874 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094001 MISSION® esiRNA esiRNA human KIAA0319L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024874 Rosetta Predictions human pricing
NM_182686 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120372 predicted 957
2 SASI_Hs01_00120374 predicted 765
3 SASI_Hs02_00357468 predicted 2601
4 SASI_Hs01_00120375 predicted 1265
5 SASI_Hs01_00120376 predicted 1168
6 SASI_Hs01_00120377 predicted 853
7 SASI_Hs01_00120378 predicted 805
8 SASI_Hs02_00357469 predicted 589
9 SASI_Hs01_00120381 predicted 1122
10 SASI_Hs02_00357470 predicted 2009
11 SASI_Hs01_00120373 predicted 816
12 SASI_Hs01_00120379 predicted 1594
13 SASI_Hs01_00120380 predicted 2318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030209 predicted 965
2 SASI_Hs01_00030211 predicted 759
3 SASI_Hs02_00370850 predicted 2600
4 SASI_Hs01_00030212 predicted 1263
5 SASI_Hs01_00030213 predicted 1167
6 SASI_Hs01_00030214 predicted 851
7 SASI_Hs01_00030215 predicted 807
8 SASI_Hs02_00370851 predicted 593
9 SASI_Hs01_00030218 predicted 1125
10 SASI_Hs02_00370852 predicted 2003
11 SASI_Hs01_00030210 predicted 818
12 SASI_Hs01_00030216 predicted 1598
13 SASI_Hs01_00030217 predicted 2323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024874
VALIDATED
KIAA0319L MISSION shRNA Bacterial Glycerol Stock
KIAA0319-like
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-4543s1c1
Sequence:CCGGGCATCAACTCATTGGGCTCTTCTCGAGAAGAGCCCAATGAGTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024874.3-3031s1c2
Sequence:CCGGGCTACCTTTGTCATTGTTGTTCTCGAGAACAACAATGACAAAGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-3072s1c1
Sequence:CCGGGACTGTGATCTGTTGTTGTAACTCGAGTTACAACAACAGATCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024874.3-3859s1c1
Sequence:CCGGCTGAGATGGTAGCATAGAAATCTCGAGATTTCTATGCTACCATCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-979s1c1
Sequence:CCGGCCTGAAATATCAGAGGGTCTTCTCGAGAAGACCCTCTGATATTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024874.3-3858s1c2
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-3858s1c1
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-958s1c1
Sequence:CCGGCCAAAGAATGTATCAGTGCAACTCGAGTTGCACTGATACATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-1489s1c1
Sequence:CCGGCCAACCACTTCTACAGTCATTCTCGAGAATGACTGTAGAAGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024874.3-3031s1c1
Sequence:CCGGGCTACCTTTGTCATTGTTGTTCTCGAGAACAACAATGACAAAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-1973s1c1
Sequence:CCGGCCACTGCTCAAGTGACTGTTACTCGAGTAACAGTCACTTGAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-4576s21c1
Sequence:CCGGGCATCAACTCATTGGGCTCTTCTCGAGAAGAGCCCAATGAGTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-1522s21c1
Sequence:CCGGCCAACCACTTCTACAGTCATTCTCGAGAATGACTGTAGAAGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-1012s21c1
Sequence:CCGGCCTGAAATATCAGAGGGTCTTCTCGAGAAGACCCTCTGATATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-3891s21c1
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-874s21c1
Sequence:CCGGGTGAATGACTCCAACGAATTACTCGAGTAATTCGTTGGAGTCATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024874
VALIDATED
KIAA0319L MISSION shRNA shRNA Plasmid DNA
KIAA0319-like
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-4543s1c1
Sequence:CCGGGCATCAACTCATTGGGCTCTTCTCGAGAAGAGCCCAATGAGTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024874.3-3031s1c2
Sequence:CCGGGCTACCTTTGTCATTGTTGTTCTCGAGAACAACAATGACAAAGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-3072s1c1
Sequence:CCGGGACTGTGATCTGTTGTTGTAACTCGAGTTACAACAACAGATCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024874.3-3859s1c1
Sequence:CCGGCTGAGATGGTAGCATAGAAATCTCGAGATTTCTATGCTACCATCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-979s1c1
Sequence:CCGGCCTGAAATATCAGAGGGTCTTCTCGAGAAGACCCTCTGATATTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024874.3-3858s1c2
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-3858s1c1
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-958s1c1
Sequence:CCGGCCAAAGAATGTATCAGTGCAACTCGAGTTGCACTGATACATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-1489s1c1
Sequence:CCGGCCAACCACTTCTACAGTCATTCTCGAGAATGACTGTAGAAGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024874.3-3031s1c1
Sequence:CCGGGCTACCTTTGTCATTGTTGTTCTCGAGAACAACAATGACAAAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-1973s1c1
Sequence:CCGGCCACTGCTCAAGTGACTGTTACTCGAGTAACAGTCACTTGAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-4576s21c1
Sequence:CCGGGCATCAACTCATTGGGCTCTTCTCGAGAAGAGCCCAATGAGTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-1522s21c1
Sequence:CCGGCCAACCACTTCTACAGTCATTCTCGAGAATGACTGTAGAAGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-1012s21c1
Sequence:CCGGCCTGAAATATCAGAGGGTCTTCTCGAGAAGACCCTCTGATATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-3891s21c1
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-874s21c1
Sequence:CCGGGTGAATGACTCCAACGAATTACTCGAGTAATTCGTTGGAGTCATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024874
VALIDATED
KIAA0319L MISSION shRNA Lentiviral Transduction Particles
KIAA0319-like
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-4543s1c1
Sequence:CCGGGCATCAACTCATTGGGCTCTTCTCGAGAAGAGCCCAATGAGTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024874.3-3031s1c2
Sequence:CCGGGCTACCTTTGTCATTGTTGTTCTCGAGAACAACAATGACAAAGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-3072s1c1
Sequence:CCGGGACTGTGATCTGTTGTTGTAACTCGAGTTACAACAACAGATCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134785    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024874.3-3859s1c1
Sequence:CCGGCTGAGATGGTAGCATAGAAATCTCGAGATTTCTATGCTACCATCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-979s1c1
Sequence:CCGGCCTGAAATATCAGAGGGTCTTCTCGAGAAGACCCTCTGATATTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024874.3-3858s1c2
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-3858s1c1
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-958s1c1
Sequence:CCGGCCAAAGAATGTATCAGTGCAACTCGAGTTGCACTGATACATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-1489s1c1
Sequence:CCGGCCAACCACTTCTACAGTCATTCTCGAGAATGACTGTAGAAGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024874.3-3031s1c1
Sequence:CCGGGCTACCTTTGTCATTGTTGTTCTCGAGAACAACAATGACAAAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024874.3-1973s1c1
Sequence:CCGGCCACTGCTCAAGTGACTGTTACTCGAGTAACAGTCACTTGAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-4576s21c1
Sequence:CCGGGCATCAACTCATTGGGCTCTTCTCGAGAAGAGCCCAATGAGTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-1522s21c1
Sequence:CCGGCCAACCACTTCTACAGTCATTCTCGAGAATGACTGTAGAAGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-1012s21c1
Sequence:CCGGCCTGAAATATCAGAGGGTCTTCTCGAGAAGACCCTCTGATATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-3891s21c1
Sequence:CCGGGCTGAGATGGTAGCATAGAAACTCGAGTTTCTATGCTACCATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024874.4-874s21c1
Sequence:CCGGGTGAATGACTCCAACGAATTACTCGAGTAATTCGTTGGAGTCATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)