EMAIL THIS PAGE TO A FRIEND

KIAA0355

KIAA0355

137 Gene Product Result for
UniProtKB ID: O15063, Q2M3W4
Gene ID:
sheep(101119330) KIAA0355 ortholog
domestic guinea pig(100720051) KIAA0355 ortholog
naked mole-rat(101721299) KIAA0355 ortholog
chicken(415782) KIAA0355
cow(617808) KIAA0355 ortholog
domestic cat(101090064) KIAA0355 ortholog
dog(612685) KIAA0355 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014570 Anti-KIAA0355 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_375600 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375600 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375600 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014686 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014671 MISSION® esiRNA esiRNA targeting human KIAA0355 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014686 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157351 predicted 1136
2 SASI_Hs01_00157352 predicted 1605
3 SASI_Hs01_00157353 predicted 2730
4 SASI_Hs01_00157354 predicted 2601
5 SASI_Hs01_00157355 predicted 2349
6 SASI_Hs01_00157356 predicted 1323
7 SASI_Hs01_00157357 predicted 1992
8 SASI_Hs01_00157358 predicted 1688
9 SASI_Hs02_00346050 predicted 1645
10 SASI_Hs01_00157359 predicted 1711
11 SASI_Hs01_00157360 predicted 2775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375600
VALIDATED
KIAA0355 MISSION shRNA Bacterial Glycerol Stock
KIAA0355
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1874s1c1
Sequence:CCGGCCGCCGACAATCTGAAACTTACTCGAGTAAGTTTCAGATTGTCGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-1144s1c1
Sequence:CCGGCTCAAAGATGTGCAGGAGCATCTCGAGATGCTCCTGCACATCTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1072s1c1
Sequence:CCGGGCCAGTACTTTCCTCACAGATCTCGAGATCTGTGAGGAAAGTACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-3688s1c1
Sequence:CCGGGATGTGAACCAGGATAACAAACTCGAGTTTGTTATCCTGGTTCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1318s1c1
Sequence:CCGGGTGCAAGTCCATTTCCAGTTTCTCGAGAAACTGGAAATGGACTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-2792s1c1
Sequence:CCGGCGTTGGTGACAAGGCATAATTCTCGAGAATTATGCCTTGTCACCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1502s1c1
Sequence:CCGGCGACATCTAGACTAAGAGAAACTCGAGTTTCTCTTAGTCTAGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375600
VALIDATED
KIAA0355 MISSION shRNA shRNA Plasmid DNA
KIAA0355
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1874s1c1
Sequence:CCGGCCGCCGACAATCTGAAACTTACTCGAGTAAGTTTCAGATTGTCGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-1144s1c1
Sequence:CCGGCTCAAAGATGTGCAGGAGCATCTCGAGATGCTCCTGCACATCTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1072s1c1
Sequence:CCGGGCCAGTACTTTCCTCACAGATCTCGAGATCTGTGAGGAAAGTACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-3688s1c1
Sequence:CCGGGATGTGAACCAGGATAACAAACTCGAGTTTGTTATCCTGGTTCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1318s1c1
Sequence:CCGGGTGCAAGTCCATTTCCAGTTTCTCGAGAAACTGGAAATGGACTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-2792s1c1
Sequence:CCGGCGTTGGTGACAAGGCATAATTCTCGAGAATTATGCCTTGTCACCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1502s1c1
Sequence:CCGGCGACATCTAGACTAAGAGAAACTCGAGTTTCTCTTAGTCTAGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375600
VALIDATED
KIAA0355 MISSION shRNA Lentiviral Transduction Particles
KIAA0355
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1874s1c1
Sequence:CCGGCCGCCGACAATCTGAAACTTACTCGAGTAAGTTTCAGATTGTCGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-1144s1c1
Sequence:CCGGCTCAAAGATGTGCAGGAGCATCTCGAGATGCTCCTGCACATCTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1072s1c1
Sequence:CCGGGCCAGTACTTTCCTCACAGATCTCGAGATCTGTGAGGAAAGTACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-3688s1c1
Sequence:CCGGGATGTGAACCAGGATAACAAACTCGAGTTTGTTATCCTGGTTCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1318s1c1
Sequence:CCGGGTGCAAGTCCATTTCCAGTTTCTCGAGAAACTGGAAATGGACTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375600.1-2792s1c1
Sequence:CCGGCGTTGGTGACAAGGCATAATTCTCGAGAATTATGCCTTGTCACCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:XM_375600.1-1502s1c1
Sequence:CCGGCGACATCTAGACTAAGAGAAACTCGAGTTTCTCTTAGTCTAGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014686
VALIDATED
KIAA0355 MISSION shRNA Bacterial Glycerol Stock
KIAA0355
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014686.3-4223s21c1
Sequence:CCGGTTGGCAGCTCCAAGCCTTTAACTCGAGTTAAAGGCTTGGAGCTGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-3233s21c1
Sequence:CCGGGGTCTGGTGAGCAGCTATATGCTCGAGCATATAGCTGCTCACCAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1382s21c1
Sequence:CCGGGTGCAAGTCCATTTCCAGTTTCTCGAGAAACTGGAAATGGACTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1136s21c1
Sequence:CCGGGCCAGTACTTTCCTCACAGATCTCGAGATCTGTGAGGAAAGTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1986s21c1
Sequence:CCGGAGGAGGCAGGCTGCTATAATGCTCGAGCATTATAGCAGCCTGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014686
VALIDATED
KIAA0355 MISSION shRNA shRNA Plasmid DNA
KIAA0355
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014686.3-4223s21c1
Sequence:CCGGTTGGCAGCTCCAAGCCTTTAACTCGAGTTAAAGGCTTGGAGCTGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-3233s21c1
Sequence:CCGGGGTCTGGTGAGCAGCTATATGCTCGAGCATATAGCTGCTCACCAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1382s21c1
Sequence:CCGGGTGCAAGTCCATTTCCAGTTTCTCGAGAAACTGGAAATGGACTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1136s21c1
Sequence:CCGGGCCAGTACTTTCCTCACAGATCTCGAGATCTGTGAGGAAAGTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1986s21c1
Sequence:CCGGAGGAGGCAGGCTGCTATAATGCTCGAGCATTATAGCAGCCTGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014686
VALIDATED
KIAA0355 MISSION shRNA Lentiviral Transduction Particles
KIAA0355
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014686.3-4223s21c1
Sequence:CCGGTTGGCAGCTCCAAGCCTTTAACTCGAGTTAAAGGCTTGGAGCTGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-3233s21c1
Sequence:CCGGGGTCTGGTGAGCAGCTATATGCTCGAGCATATAGCTGCTCACCAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1382s21c1
Sequence:CCGGGTGCAAGTCCATTTCCAGTTTCTCGAGAAACTGGAAATGGACTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1136s21c1
Sequence:CCGGGCCAGTACTTTCCTCACAGATCTCGAGATCTGTGAGGAAAGTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014686.3-1986s21c1
Sequence:CCGGAGGAGGCAGGCTGCTATAATGCTCGAGCATTATAGCAGCCTGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)