EMAIL THIS PAGE TO A FRIEND

KIAA0368

KIAA0368

59 Gene Product Result for
Synonyms: ECM29
Gene ID:
chicken(427336) KIAA0368
cow(513555) KIAA0368 ortholog
domestic cat(101093214) KIAA0368 ortholog
dog(100687244) KIAA0368 ortholog
domestic guinea pig(100715568) KIAA0368 ortholog
naked mole-rat(101710682) KIAA0368 ortholog
sheep(101112375) KIAA0368 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0111 AQUA Peptide AGEQLAPFLPQLVP[R] cow, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080398 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092101 MISSION® esiRNA esiRNA human KIAA0368 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080398 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314471 predicted 2457
2 SASI_Hs02_00314472 predicted 4119
3 SASI_Hs02_00314473 predicted 3221
4 SASI_Hs02_00314474 predicted 1962
5 SASI_Hs02_00314475 predicted 2519
6 SASI_Hs02_00314476 predicted 4505
7 SASI_Hs02_00314477 predicted 1902
8 SASI_Hs02_00314478 predicted 4025
9 SASI_Hs02_00314479 predicted 2049
10 SASI_Hs02_00314480 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080398
VALIDATED
KIAA0368 MISSION shRNA Bacterial Glycerol Stock
KIAA0368
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000263353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080398.1-1643s21c1
Sequence:CCGGTGCAATTTGTGCATCATATTTCTCGAGAAATATGATGCACAAATTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080398.1-2395s21c1
Sequence:CCGGGGGCGCTACATACGGACTTTACTCGAGTAAAGTCCGTATGTAGCGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080398.1-6905s21c1
Sequence:CCGGTGCCGTGGTTTAGACCATTTACTCGAGTAAATGGTCTAAACCACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080398.1-1065s21c1
Sequence:CCGGGCCTTATGGTTACGTGTTAAACTCGAGTTTAACACGTAACCATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080398
VALIDATED
KIAA0368 MISSION shRNA shRNA Plasmid DNA
KIAA0368
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000263353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080398.1-1643s21c1
Sequence:CCGGTGCAATTTGTGCATCATATTTCTCGAGAAATATGATGCACAAATTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080398.1-2395s21c1
Sequence:CCGGGGGCGCTACATACGGACTTTACTCGAGTAAAGTCCGTATGTAGCGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080398.1-6905s21c1
Sequence:CCGGTGCCGTGGTTTAGACCATTTACTCGAGTAAATGGTCTAAACCACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080398.1-1065s21c1
Sequence:CCGGGCCTTATGGTTACGTGTTAAACTCGAGTTTAACACGTAACCATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080398
VALIDATED
KIAA0368 MISSION shRNA Lentiviral Transduction Particles
KIAA0368
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000263353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080398.1-1643s21c1
Sequence:CCGGTGCAATTTGTGCATCATATTTCTCGAGAAATATGATGCACAAATTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080398.1-2395s21c1
Sequence:CCGGGGGCGCTACATACGGACTTTACTCGAGTAAAGTCCGTATGTAGCGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080398.1-6905s21c1
Sequence:CCGGTGCCGTGGTTTAGACCATTTACTCGAGTAAATGGTCTAAACCACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080398.1-1065s21c1
Sequence:CCGGGCCTTATGGTTACGTGTTAAACTCGAGTTTAACACGTAACCATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)