EMAIL THIS PAGE TO A FRIEND

KIAA0391

KIAA0391

41 Gene Product Result for
Synonyms: MRPP3 PRORP
Gene ID:
sheep(101119677) KIAA0391 ortholog
domestic guinea pig(101787723) KIAA0391 ortholog
naked mole-rat(101704541) KIAA0391 ortholog
chicken(423325) KIAA0391
domestic cat(101090113) KIAA0391 ortholog
dog(490650) KIAA0391 ortholog
cow(532995) KIAA0391 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014672 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082571 MISSION® esiRNA esiRNA human KIAA0391 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014672 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346024 predicted 363
2 SASI_Hs01_00093979 predicted 1819
3 SASI_Hs01_00093980 predicted 883
4 SASI_Hs01_00093981 predicted 959
5 SASI_Hs01_00093982 predicted 1363
6 SASI_Hs01_00093983 predicted 873
7 SASI_Hs01_00093984 predicted 1419
8 SASI_Hs01_00093985 predicted 1506
9 SASI_Hs01_00093986 predicted 813
10 SASI_Hs01_00093987 predicted 978
11 SASI_Hs01_00093988 predicted 932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014672
KIAA0391 MISSION shRNA Bacterial Glycerol Stock
KIAA0391
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014672.2-2386s21c1
Sequence:CCGGCACTTAGCTTGGGTGACTAATCTCGAGATTAGTCACCCAAGCTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-819s21c1
Sequence:CCGGCTCTATAGATGTGGCTAAATCCTCGAGGATTTAGCCACATCTATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-1165s21c1
Sequence:CCGGGAATTGCTAGGTCATGATATTCTCGAGAATATCATGACCTAGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-884s21c1
Sequence:CCGGACGATTTACTGGTCAAGTATTCTCGAGAATACTTGACCAGTAAATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-776s21c1
Sequence:CCGGGTTTCGAAAGTTGGATCATTTCTCGAGAAATGATCCAACTTTCGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-1827s1c1
Sequence:CCGGCGGGAATCACTGCAGGTTTATCTCGAGATAAACCTGCAGTGATTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014672.2-2485s1c1
Sequence:CCGGCCTGAGATACTCATGTTGTTTCTCGAGAAACAACATGAGTATCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014672.2-2455s1c1
Sequence:CCGGCCTACCAATAGCAGAATCAATCTCGAGATTGATTCTGCTATTGGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-520s1c1
Sequence:CCGGCAGAATACCAAAGCAACGAATCTCGAGATTCGTTGCTTTGGTATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-1777s1c1
Sequence:CCGGGATGACATCTCGGAGGATGATCTCGAGATCATCCTCCGAGATGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014672
KIAA0391 MISSION shRNA shRNA Plasmid DNA
KIAA0391
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014672.2-2386s21c1
Sequence:CCGGCACTTAGCTTGGGTGACTAATCTCGAGATTAGTCACCCAAGCTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-819s21c1
Sequence:CCGGCTCTATAGATGTGGCTAAATCCTCGAGGATTTAGCCACATCTATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-1165s21c1
Sequence:CCGGGAATTGCTAGGTCATGATATTCTCGAGAATATCATGACCTAGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-884s21c1
Sequence:CCGGACGATTTACTGGTCAAGTATTCTCGAGAATACTTGACCAGTAAATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-776s21c1
Sequence:CCGGGTTTCGAAAGTTGGATCATTTCTCGAGAAATGATCCAACTTTCGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-1827s1c1
Sequence:CCGGCGGGAATCACTGCAGGTTTATCTCGAGATAAACCTGCAGTGATTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014672.2-2485s1c1
Sequence:CCGGCCTGAGATACTCATGTTGTTTCTCGAGAAACAACATGAGTATCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014672.2-2455s1c1
Sequence:CCGGCCTACCAATAGCAGAATCAATCTCGAGATTGATTCTGCTATTGGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-520s1c1
Sequence:CCGGCAGAATACCAAAGCAACGAATCTCGAGATTCGTTGCTTTGGTATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-1777s1c1
Sequence:CCGGGATGACATCTCGGAGGATGATCTCGAGATCATCCTCCGAGATGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014672
KIAA0391 MISSION shRNA Lentiviral Transduction Particles
KIAA0391
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014672.2-2386s21c1
Sequence:CCGGCACTTAGCTTGGGTGACTAATCTCGAGATTAGTCACCCAAGCTAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-819s21c1
Sequence:CCGGCTCTATAGATGTGGCTAAATCCTCGAGGATTTAGCCACATCTATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-1165s21c1
Sequence:CCGGGAATTGCTAGGTCATGATATTCTCGAGAATATCATGACCTAGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-884s21c1
Sequence:CCGGACGATTTACTGGTCAAGTATTCTCGAGAATACTTGACCAGTAAATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014672.2-776s21c1
Sequence:CCGGGTTTCGAAAGTTGGATCATTTCTCGAGAAATGATCCAACTTTCGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-1827s1c1
Sequence:CCGGCGGGAATCACTGCAGGTTTATCTCGAGATAAACCTGCAGTGATTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014672.2-2485s1c1
Sequence:CCGGCCTGAGATACTCATGTTGTTTCTCGAGAAACAACATGAGTATCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014672.2-2455s1c1
Sequence:CCGGCCTACCAATAGCAGAATCAATCTCGAGATTGATTCTGCTATTGGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-520s1c1
Sequence:CCGGCAGAATACCAAAGCAACGAATCTCGAGATTCGTTGCTTTGGTATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014672.2-1777s1c1
Sequence:CCGGGATGACATCTCGGAGGATGATCTCGAGATCATCCTCCGAGATGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)