EMAIL THIS PAGE TO A FRIEND

KIAA0430

KIAA0430

107 Gene Product Result for
Synonyms: LKAP MARF1 PPP1R34
Gene ID:
Human(9665) Summary: This gene encodes a putative peroxisomal protein that appears to be conserved across Euteleostomi. In humans, it may be autoantigenic. [provided by RefSeq, Jul 2010]
chicken(416595) KIAA0430
dog(479837) KIAA0430 ortholog
domestic cat(101098675) KIAA0430 ortholog
sheep(101110728) KIAA0430 ortholog
domestic guinea pig(100715177) KIAA0430 ortholog
naked mole-rat(101720588) KIAA0430 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019081 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014647 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069521 MISSION® esiRNA esiRNA human KIAA0430 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014647 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106957 predicted 3610
2 SASI_Hs02_00345970 predicted 618
3 SASI_Hs01_00106958 predicted 1726
4 SASI_Hs01_00106959 predicted 1647
5 SASI_Hs02_00345971 predicted 2805
6 SASI_Hs01_00106960 predicted 1950
7 SASI_Hs01_00106961 predicted 4326
8 SASI_Hs01_00106962 predicted 3300
9 SASI_Hs01_00106963 predicted 2366
10 SASI_Hs02_00345972 predicted 4247
11 SASI_Hs01_00106956 predicted 1365
12 SASI_Hs01_00106964 predicted 4416
13 SASI_Hs01_00106965 predicted 1040
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019081
VALIDATED
KIAA0430 MISSION shRNA Bacterial Glycerol Stock
KIAA0430
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_019081.2-3718s1c1
Sequence:CCGGGCCCAGTTTGTTAAACTCCTTCTCGAGAAGGAGTTTAACAAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-3553s1c1
Sequence:CCGGCCTTCTTACCATCACCACTTTCTCGAGAAAGTGGTGATGGTAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_019081.2-3229s1c1
Sequence:CCGGCGCTTTACTCAGGATTTACTACTCGAGTAGTAAATCCTGAGTAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-4629s1c1
Sequence:CCGGCCTCCAATCTGCTGATCTCATCTCGAGATGAGATCAGCAGATTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-4168s1c1
Sequence:CCGGGCAAAGAATGTGCGGTCTTTACTCGAGTAAAGACCGCACATTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019081
VALIDATED
KIAA0430 MISSION shRNA shRNA Plasmid DNA
KIAA0430
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_019081.2-3718s1c1
Sequence:CCGGGCCCAGTTTGTTAAACTCCTTCTCGAGAAGGAGTTTAACAAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-3553s1c1
Sequence:CCGGCCTTCTTACCATCACCACTTTCTCGAGAAAGTGGTGATGGTAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_019081.2-3229s1c1
Sequence:CCGGCGCTTTACTCAGGATTTACTACTCGAGTAGTAAATCCTGAGTAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-4629s1c1
Sequence:CCGGCCTCCAATCTGCTGATCTCATCTCGAGATGAGATCAGCAGATTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-4168s1c1
Sequence:CCGGGCAAAGAATGTGCGGTCTTTACTCGAGTAAAGACCGCACATTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019081
VALIDATED
KIAA0430 MISSION shRNA Lentiviral Transduction Particles
KIAA0430
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_019081.2-3718s1c1
Sequence:CCGGGCCCAGTTTGTTAAACTCCTTCTCGAGAAGGAGTTTAACAAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-3553s1c1
Sequence:CCGGCCTTCTTACCATCACCACTTTCTCGAGAAAGTGGTGATGGTAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_019081.2-3229s1c1
Sequence:CCGGCGCTTTACTCAGGATTTACTACTCGAGTAGTAAATCCTGAGTAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-4629s1c1
Sequence:CCGGCCTCCAATCTGCTGATCTCATCTCGAGATGAGATCAGCAGATTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019081.2-4168s1c1
Sequence:CCGGGCAAAGAATGTGCGGTCTTTACTCGAGTAAAGACCGCACATTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014647
KIAA0430 MISSION shRNA Bacterial Glycerol Stock
KIAA0430
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014647.2-5837s21c1
Sequence:CCGGACTGGTGTTTCCGACAGTATTCTCGAGAATACTGTCGGAAACACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-1842s21c1
Sequence:CCGGGTGCAATTCTCCGCTTCATAACTCGAGTTATGAAGCGGAGAATTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-4367s21c1
Sequence:CCGGGTCGTGAAGGTTGCCGATATACTCGAGTATATCGGCAACCTTCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-1788s21c1
Sequence:CCGGTCAGACGCCTGTCCGATAATTCTCGAGAATTATCGGACAGGCGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-2927s21c1
Sequence:CCGGTTGAATGTGTCAGATCTATATCTCGAGATATAGATCTGACACATTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014647
KIAA0430 MISSION shRNA shRNA Plasmid DNA
KIAA0430
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014647.2-5837s21c1
Sequence:CCGGACTGGTGTTTCCGACAGTATTCTCGAGAATACTGTCGGAAACACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-1842s21c1
Sequence:CCGGGTGCAATTCTCCGCTTCATAACTCGAGTTATGAAGCGGAGAATTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-4367s21c1
Sequence:CCGGGTCGTGAAGGTTGCCGATATACTCGAGTATATCGGCAACCTTCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-1788s21c1
Sequence:CCGGTCAGACGCCTGTCCGATAATTCTCGAGAATTATCGGACAGGCGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-2927s21c1
Sequence:CCGGTTGAATGTGTCAGATCTATATCTCGAGATATAGATCTGACACATTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014647
KIAA0430 MISSION shRNA Lentiviral Transduction Particles
KIAA0430
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014647.2-5837s21c1
Sequence:CCGGACTGGTGTTTCCGACAGTATTCTCGAGAATACTGTCGGAAACACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-1842s21c1
Sequence:CCGGGTGCAATTCTCCGCTTCATAACTCGAGTTATGAAGCGGAGAATTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-4367s21c1
Sequence:CCGGGTCGTGAAGGTTGCCGATATACTCGAGTATATCGGCAACCTTCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-1788s21c1
Sequence:CCGGTCAGACGCCTGTCCGATAATTCTCGAGAATTATCGGACAGGCGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014647.2-2927s21c1
Sequence:CCGGTTGAATGTGTCAGATCTATATCTCGAGATATAGATCTGACACATTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)