EMAIL THIS PAGE TO A FRIEND

KIAA0513

KIAA0513

46 Gene Product Result for
UniProtKB ID: O60268, D3DUM2, Q8N6G0
Gene ID:
chicken(772040) KIAA0513
dog(489675) KIAA0513 ortholog
domestic cat(101092979) KIAA0513 ortholog
cow(507534) KIAA0513 ortholog
sheep(101104418) KIAA0513 ortholog
domestic guinea pig(100715075) KIAA0513 ortholog
naked mole-rat(101698936) KIAA0513 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014732 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076951 MISSION® esiRNA esiRNA human KIAA0513 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014732 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163136 predicted 673
2 SASI_Hs01_00163137 predicted 770
3 SASI_Hs01_00163138 predicted 575
4 SASI_Hs01_00163139 predicted 866
5 SASI_Hs01_00163141 predicted 580
6 SASI_Hs01_00163142 predicted 1351
7 SASI_Hs01_00163143 predicted 725
8 SASI_Hs01_00163144 predicted 734
9 SASI_Hs01_00163145 predicted 1574
10 SASI_Hs02_00346176 predicted 1231
11 SASI_Hs01_00163140 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014732
KIAA0513 MISSION shRNA Bacterial Glycerol Stock
KIAA0513
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014732.2-1163s21c1
Sequence:CCGGGTCCATTGTGAGAGGACAAAGCTCGAGCTTTGTCCTCTCACAATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-715s1c1
Sequence:CCGGGCTGTTCGAGTGTCATCAGATCTCGAGATCTGATGACACTCGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-571s1c1
Sequence:CCGGGAAAGCCAAGTTTGGAGAGTACTCGAGTACTCTCCAAACTTGGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014732.2-1348s1c1
Sequence:CCGGCAAGAAGCTGTGCAATGACTTCTCGAGAAGTCATTGCACAGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014732.2-5810s1c1
Sequence:CCGGCGTGTATTCATGTTGATGATTCTCGAGAATCATCAACATGAATACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014732.2-554s1c1
Sequence:CCGGGACTTGGATCAGGAGGAGAAACTCGAGTTTCTCCTCCTGATCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014732.2-2365s1c1
Sequence:CCGGGCTGCTCTTTATTCCAGACAACTCGAGTTGTCTGGAATAAAGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-1403s1c1
Sequence:CCGGGAAGAGCAATACAAGCTGCTTCTCGAGAAGCAGCTTGTATTGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014732
KIAA0513 MISSION shRNA shRNA Plasmid DNA
KIAA0513
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014732.2-1163s21c1
Sequence:CCGGGTCCATTGTGAGAGGACAAAGCTCGAGCTTTGTCCTCTCACAATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-715s1c1
Sequence:CCGGGCTGTTCGAGTGTCATCAGATCTCGAGATCTGATGACACTCGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-571s1c1
Sequence:CCGGGAAAGCCAAGTTTGGAGAGTACTCGAGTACTCTCCAAACTTGGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014732.2-1348s1c1
Sequence:CCGGCAAGAAGCTGTGCAATGACTTCTCGAGAAGTCATTGCACAGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014732.2-5810s1c1
Sequence:CCGGCGTGTATTCATGTTGATGATTCTCGAGAATCATCAACATGAATACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014732.2-554s1c1
Sequence:CCGGGACTTGGATCAGGAGGAGAAACTCGAGTTTCTCCTCCTGATCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014732.2-2365s1c1
Sequence:CCGGGCTGCTCTTTATTCCAGACAACTCGAGTTGTCTGGAATAAAGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-1403s1c1
Sequence:CCGGGAAGAGCAATACAAGCTGCTTCTCGAGAAGCAGCTTGTATTGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014732
KIAA0513 MISSION shRNA Lentiviral Transduction Particles
KIAA0513
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014732.2-1163s21c1
Sequence:CCGGGTCCATTGTGAGAGGACAAAGCTCGAGCTTTGTCCTCTCACAATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-715s1c1
Sequence:CCGGGCTGTTCGAGTGTCATCAGATCTCGAGATCTGATGACACTCGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-571s1c1
Sequence:CCGGGAAAGCCAAGTTTGGAGAGTACTCGAGTACTCTCCAAACTTGGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014732.2-1348s1c1
Sequence:CCGGCAAGAAGCTGTGCAATGACTTCTCGAGAAGTCATTGCACAGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014732.2-5810s1c1
Sequence:CCGGCGTGTATTCATGTTGATGATTCTCGAGAATCATCAACATGAATACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014732.2-554s1c1
Sequence:CCGGGACTTGGATCAGGAGGAGAAACTCGAGTTTCTCCTCCTGATCCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014732.2-2365s1c1
Sequence:CCGGGCTGCTCTTTATTCCAGACAACTCGAGTTGTCTGGAATAAAGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014732.2-1403s1c1
Sequence:CCGGGAAGAGCAATACAAGCTGCTTCTCGAGAAGCAGCTTGTATTGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)