EMAIL THIS PAGE TO A FRIEND

KIAA0556

KIAA0556

73 Gene Product Result for
UniProtKB ID: O60303, A7E2C2
Gene ID:
chicken(426427) KIAA0556 ortholog
cow(520970) KIAA0556 ortholog
cow(614990) kiaa0556 protein
domestic cat(101095302) KIAA0556 ortholog
dog(479799) KIAA0556 ortholog
sheep(101120464) KIAA0556 ortholog
domestic guinea pig(100722392) KIAA0556 ortholog
naked mole-rat(101705700) KIAA0556 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015202 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078271 MISSION® esiRNA esiRNA human KIAA0556 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015202 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015109 predicted 2981
2 SASI_Hs02_00347289 predicted 632
3 SASI_Hs01_00015111 predicted 4770
4 SASI_Hs01_00015112 predicted 3385
5 SASI_Hs01_00015113 predicted 1913
6 SASI_Hs01_00015114 predicted 321
7 SASI_Hs01_00015115 predicted 273
8 SASI_Hs01_00015117 predicted 613
9 SASI_Hs01_00015118 predicted 2431
10 SASI_Hs02_00347290 predicted 2708
11 SASI_Hs01_00015110 predicted 1723
12 SASI_Hs01_00015116 predicted 3378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015202
VALIDATED
KIAA0556 MISSION shRNA Bacterial Glycerol Stock
KIAA0556
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015202.1-341s1c1
Sequence:CCGGCGAAGAACTCTGTTTCGAGAACTCGAGTTCTCGAAACAGAGTTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-2010s1c1
Sequence:CCGGCTGAAACATTAGCGGATGCAACTCGAGTTGCATCCGCTAATGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015202.1-6143s1c1
Sequence:CCGGCGGCAAATACTTCATGAGCTTCTCGAGAAGCTCATGAAGTATTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-621s1c1
Sequence:CCGGCCAGCGATGAGTATGACTCTACTCGAGTAGAGTCATACTCATCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-1765s1c1
Sequence:CCGGCGATCTTGACATTGGTGCCAACTCGAGTTGGCACCAATGTCAAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-533s1c1
Sequence:CCGGGCAAACAACACTTCTGAGGATCTCGAGATCCTCAGAAGTGTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015202.1-5191s1c1
Sequence:CCGGCCTGACTCAGAACAGGACAATCTCGAGATTGTCCTGTTCTGAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-160s1c1
Sequence:CCGGCCGGATATTAAAGCATTTGAACTCGAGTTCAAATGCTTTAATATCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-4778s1c1
Sequence:CCGGCAAATCATTACCAACGCGAAACTCGAGTTTCGCGTTGGTAATGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-3422s1c1
Sequence:CCGGGAGGCCATATTCTATTCTGATCTCGAGATCAGAATAGAATATGGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-798s21c1
Sequence:CCGGCCTCGTGGTGCTGGAATTTAACTCGAGTTAAATTCCAGCACCACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-2993s21c1
Sequence:CCGGATGTCGGCCTCAACGGAATAGCTCGAGCTATTCCGTTGAGGCCGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-3064s21c1
Sequence:CCGGGACCCTCCCGATATCAATATTCTCGAGAATATTGATATCGGGAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015202.2-5041s21c1
Sequence:CCGGATACTACCAGAGTGACAGATGCTCGAGCATCTGTCACTCTGGTAGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-3230s21c1
Sequence:CCGGACGTTGCCCTGATCAGAATTTCTCGAGAAATTCTGATCAGGGCAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-585s21c1
Sequence:CCGGACTTAGTGTAAATCTACAAAGCTCGAGCTTTGTAGATTTACACTAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-1607s21c1
Sequence:CCGGGCCTCGTCAACAGGAACTTAGCTCGAGCTAAGTTCCTGTTGACGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-1427s21c1
Sequence:CCGGTGAGGGCAGACGAGATCAAAGCTCGAGCTTTGATCTCGTCTGCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015202
VALIDATED
KIAA0556 MISSION shRNA shRNA Plasmid DNA
KIAA0556
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015202.1-341s1c1
Sequence:CCGGCGAAGAACTCTGTTTCGAGAACTCGAGTTCTCGAAACAGAGTTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-2010s1c1
Sequence:CCGGCTGAAACATTAGCGGATGCAACTCGAGTTGCATCCGCTAATGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015202.1-6143s1c1
Sequence:CCGGCGGCAAATACTTCATGAGCTTCTCGAGAAGCTCATGAAGTATTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-621s1c1
Sequence:CCGGCCAGCGATGAGTATGACTCTACTCGAGTAGAGTCATACTCATCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-1765s1c1
Sequence:CCGGCGATCTTGACATTGGTGCCAACTCGAGTTGGCACCAATGTCAAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-533s1c1
Sequence:CCGGGCAAACAACACTTCTGAGGATCTCGAGATCCTCAGAAGTGTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015202.1-5191s1c1
Sequence:CCGGCCTGACTCAGAACAGGACAATCTCGAGATTGTCCTGTTCTGAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-160s1c1
Sequence:CCGGCCGGATATTAAAGCATTTGAACTCGAGTTCAAATGCTTTAATATCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-4778s1c1
Sequence:CCGGCAAATCATTACCAACGCGAAACTCGAGTTTCGCGTTGGTAATGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-3422s1c1
Sequence:CCGGGAGGCCATATTCTATTCTGATCTCGAGATCAGAATAGAATATGGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-798s21c1
Sequence:CCGGCCTCGTGGTGCTGGAATTTAACTCGAGTTAAATTCCAGCACCACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-2993s21c1
Sequence:CCGGATGTCGGCCTCAACGGAATAGCTCGAGCTATTCCGTTGAGGCCGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-3064s21c1
Sequence:CCGGGACCCTCCCGATATCAATATTCTCGAGAATATTGATATCGGGAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015202.2-5041s21c1
Sequence:CCGGATACTACCAGAGTGACAGATGCTCGAGCATCTGTCACTCTGGTAGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-3230s21c1
Sequence:CCGGACGTTGCCCTGATCAGAATTTCTCGAGAAATTCTGATCAGGGCAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-585s21c1
Sequence:CCGGACTTAGTGTAAATCTACAAAGCTCGAGCTTTGTAGATTTACACTAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-1607s21c1
Sequence:CCGGGCCTCGTCAACAGGAACTTAGCTCGAGCTAAGTTCCTGTTGACGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-1427s21c1
Sequence:CCGGTGAGGGCAGACGAGATCAAAGCTCGAGCTTTGATCTCGTCTGCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015202
VALIDATED
KIAA0556 MISSION shRNA Lentiviral Transduction Particles
KIAA0556
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015202.1-341s1c1
Sequence:CCGGCGAAGAACTCTGTTTCGAGAACTCGAGTTCTCGAAACAGAGTTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-2010s1c1
Sequence:CCGGCTGAAACATTAGCGGATGCAACTCGAGTTGCATCCGCTAATGTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141163    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015202.1-6143s1c1
Sequence:CCGGCGGCAAATACTTCATGAGCTTCTCGAGAAGCTCATGAAGTATTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-621s1c1
Sequence:CCGGCCAGCGATGAGTATGACTCTACTCGAGTAGAGTCATACTCATCGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-1765s1c1
Sequence:CCGGCGATCTTGACATTGGTGCCAACTCGAGTTGGCACCAATGTCAAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015202.1-533s1c1
Sequence:CCGGGCAAACAACACTTCTGAGGATCTCGAGATCCTCAGAAGTGTTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122358    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015202.1-5191s1c1
Sequence:CCGGCCTGACTCAGAACAGGACAATCTCGAGATTGTCCTGTTCTGAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-160s1c1
Sequence:CCGGCCGGATATTAAAGCATTTGAACTCGAGTTCAAATGCTTTAATATCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-4778s1c1
Sequence:CCGGCAAATCATTACCAACGCGAAACTCGAGTTTCGCGTTGGTAATGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015202.1-3422s1c1
Sequence:CCGGGAGGCCATATTCTATTCTGATCTCGAGATCAGAATAGAATATGGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-798s21c1
Sequence:CCGGCCTCGTGGTGCTGGAATTTAACTCGAGTTAAATTCCAGCACCACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-2993s21c1
Sequence:CCGGATGTCGGCCTCAACGGAATAGCTCGAGCTATTCCGTTGAGGCCGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-3064s21c1
Sequence:CCGGGACCCTCCCGATATCAATATTCTCGAGAATATTGATATCGGGAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015202.2-5041s21c1
Sequence:CCGGATACTACCAGAGTGACAGATGCTCGAGCATCTGTCACTCTGGTAGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-3230s21c1
Sequence:CCGGACGTTGCCCTGATCAGAATTTCTCGAGAAATTCTGATCAGGGCAACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-585s21c1
Sequence:CCGGACTTAGTGTAAATCTACAAAGCTCGAGCTTTGTAGATTTACACTAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-1607s21c1
Sequence:CCGGGCCTCGTCAACAGGAACTTAGCTCGAGCTAAGTTCCTGTTGACGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015202.2-1427s21c1
Sequence:CCGGTGAGGGCAGACGAGATCAAAGCTCGAGCTTTGATCTCGTCTGCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)