EMAIL THIS PAGE TO A FRIEND

KIAA0586

KIAA0586

25 Gene Product Result for
Synonyms: Talpid3
Gene ID:
chicken(423540) KIAA0586
domestic cat(101097900) KIAA0586 ortholog
cow(533397) KIAA0586
dog(480340) KIAA0586 ortholog
domestic guinea pig(100726668) KIAA0586 ortholog
naked mole-rat(101709027) KIAA0586 ortholog
sheep(101122953) KIAA0586 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014749 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085921 MISSION® esiRNA esiRNA human KIAA0586 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014749 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226639 predicted 2483
2 SASI_Hs02_00346214 predicted 2224
3 SASI_Hs01_00226640 predicted 3905
4 SASI_Hs01_00226641 predicted 1025
5 SASI_Hs01_00226642 predicted 1674
6 SASI_Hs01_00226643 predicted 1176
7 SASI_Hs02_00346215 predicted 4012
8 SASI_Hs01_00226645 predicted 1781
9 SASI_Hs02_00346216 predicted 3462
10 SASI_Hs01_00226646 predicted 2146
11 SASI_Hs01_00226644 predicted 4584
12 SASI_Hs01_00226647 predicted 4254
13 SASI_Hs01_00226648 predicted 2803
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014749
VALIDATED
KIAA0586 MISSION shRNA Bacterial Glycerol Stock
KIAA0586
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014749.3-5002s21c1
Sequence:CCGGATTATGTAGCTCAAGGTTATTCTCGAGAATAACCTTGAGCTACATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014749.3-2474s21c1
Sequence:CCGGAGCTTACTGTGCAGGTATTACCTCGAGGTAATACCTGCACAGTAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014749.2-714s1c1
Sequence:CCGGGCAGAGTGATTTGGAAGCAAACTCGAGTTTGCTTCCAAATCACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014749.2-4843s1c1
Sequence:CCGGCTCTCTCAGACTGTTTGGTTTCTCGAGAAACCAAACAGTCTGAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014749.2-3374s1c1
Sequence:CCGGCCTGTGATTCGGATCATGATACTCGAGTATCATGATCCGAATCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014749.2-4794s1c1
Sequence:CCGGCAGTGTTTATGCCACTGGTTTCTCGAGAAACCAGTGGCATAAACACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014749.2-1032s1c1
Sequence:CCGGCCCTAATCTTGGTAGCTGTAACTCGAGTTACAGCTACCAAGATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014749.2-4273s1c1
Sequence:CCGGCGGCAATTTGACACAGTTTCACTCGAGTGAAACTGTGTCAAATTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014749
VALIDATED
KIAA0586 MISSION shRNA shRNA Plasmid DNA
KIAA0586
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014749.3-5002s21c1
Sequence:CCGGATTATGTAGCTCAAGGTTATTCTCGAGAATAACCTTGAGCTACATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014749.3-2474s21c1
Sequence:CCGGAGCTTACTGTGCAGGTATTACCTCGAGGTAATACCTGCACAGTAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014749.2-714s1c1
Sequence:CCGGGCAGAGTGATTTGGAAGCAAACTCGAGTTTGCTTCCAAATCACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014749.2-4843s1c1
Sequence:CCGGCTCTCTCAGACTGTTTGGTTTCTCGAGAAACCAAACAGTCTGAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014749.2-3374s1c1
Sequence:CCGGCCTGTGATTCGGATCATGATACTCGAGTATCATGATCCGAATCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014749.2-4794s1c1
Sequence:CCGGCAGTGTTTATGCCACTGGTTTCTCGAGAAACCAGTGGCATAAACACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014749.2-1032s1c1
Sequence:CCGGCCCTAATCTTGGTAGCTGTAACTCGAGTTACAGCTACCAAGATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014749.2-4273s1c1
Sequence:CCGGCGGCAATTTGACACAGTTTCACTCGAGTGAAACTGTGTCAAATTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014749
VALIDATED
KIAA0586 MISSION shRNA Lentiviral Transduction Particles
KIAA0586
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014749.3-5002s21c1
Sequence:CCGGATTATGTAGCTCAAGGTTATTCTCGAGAATAACCTTGAGCTACATAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014749.3-2474s21c1
Sequence:CCGGAGCTTACTGTGCAGGTATTACCTCGAGGTAATACCTGCACAGTAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014749.2-714s1c1
Sequence:CCGGGCAGAGTGATTTGGAAGCAAACTCGAGTTTGCTTCCAAATCACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014749.2-4843s1c1
Sequence:CCGGCTCTCTCAGACTGTTTGGTTTCTCGAGAAACCAAACAGTCTGAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014749.2-3374s1c1
Sequence:CCGGCCTGTGATTCGGATCATGATACTCGAGTATCATGATCCGAATCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014749.2-4794s1c1
Sequence:CCGGCAGTGTTTATGCCACTGGTTTCTCGAGAAACCAGTGGCATAAACACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014749.2-1032s1c1
Sequence:CCGGCCCTAATCTTGGTAGCTGTAACTCGAGTTACAGCTACCAAGATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014749.2-4273s1c1
Sequence:CCGGCGGCAATTTGACACAGTTTCACTCGAGTGAAACTGTGTCAAATTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)