EMAIL THIS PAGE TO A FRIEND

KIAA0753

KIAA0753

83 Gene Product Result for
Gene ID:
chicken(417681) KIAA0753
cow(512933) KIAA0753 ortholog
domestic cat(101088528) KIAA0753 ortholog
dog(607016) KIAA0753 ortholog
sheep(101104412) KIAA0753 ortholog
domestic guinea pig(100723920) KIAA0753 ortholog
naked mole-rat(101706069) KIAA0753 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014804 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100821 MISSION® esiRNA esiRNA human KIAA0753 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014804 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052378 predicted 3017
2 SASI_Hs01_00052381 predicted 3239
3 SASI_Hs02_00346321 predicted 2439
4 SASI_Hs01_00052382 predicted 682
5 SASI_Hs01_00052383 predicted 1229
6 SASI_Hs01_00052384 predicted 745
7 SASI_Hs01_00052385 predicted 2276
8 SASI_Hs02_00346322 predicted 2890
9 SASI_Hs01_00052386 predicted 864
10 SASI_Hs01_00052387 predicted 1447
11 SASI_Hs01_00052379 predicted 984
12 SASI_Hs01_00052380 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014804
VALIDATED
KIAA0753 MISSION shRNA Bacterial Glycerol Stock
KIAA0753
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014804.1-2823s1c1
Sequence:CCGGGAGCAGTACCTTCGGATCATACTCGAGTATGATCCGAAGGTACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014804.2-493s21c1
Sequence:CCGGGCAACTTGGCGATCCGATATTCTCGAGAATATCGGATCGCCAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014804.2-1731s21c1
Sequence:CCCGGATGTATTAGATGCGGATATACTCGAGTATATCCGCATCTAATACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014804.1-204s1c1
Sequence:CCGGCTGCAGTTTAATAGGAATGTTCTCGAGAACATTCCTATTAAACTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014804.1-1173s1c1
Sequence:CCGGCCTGATGTGGTTATAGATATTCTCGAGAATATCTATAACCACATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014804.1-3353s1c1
Sequence:CCGGCGTATATTTCACACAAGGATTCTCGAGAATCCTTGTGTGAAATATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014804.1-2443s1c1
Sequence:CCGGGCCGAATGGAAGAGATGGAAACTCGAGTTTCCATCTCTTCCATTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014804
VALIDATED
KIAA0753 MISSION shRNA shRNA Plasmid DNA
KIAA0753
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014804.1-2823s1c1
Sequence:CCGGGAGCAGTACCTTCGGATCATACTCGAGTATGATCCGAAGGTACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014804.2-493s21c1
Sequence:CCGGGCAACTTGGCGATCCGATATTCTCGAGAATATCGGATCGCCAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014804.2-1731s21c1
Sequence:CCCGGATGTATTAGATGCGGATATACTCGAGTATATCCGCATCTAATACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014804.1-204s1c1
Sequence:CCGGCTGCAGTTTAATAGGAATGTTCTCGAGAACATTCCTATTAAACTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014804.1-1173s1c1
Sequence:CCGGCCTGATGTGGTTATAGATATTCTCGAGAATATCTATAACCACATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014804.1-3353s1c1
Sequence:CCGGCGTATATTTCACACAAGGATTCTCGAGAATCCTTGTGTGAAATATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014804.1-2443s1c1
Sequence:CCGGGCCGAATGGAAGAGATGGAAACTCGAGTTTCCATCTCTTCCATTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014804
VALIDATED
KIAA0753 MISSION shRNA Lentiviral Transduction Particles
KIAA0753
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014804.1-2823s1c1
Sequence:CCGGGAGCAGTACCTTCGGATCATACTCGAGTATGATCCGAAGGTACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014804.2-493s21c1
Sequence:CCGGGCAACTTGGCGATCCGATATTCTCGAGAATATCGGATCGCCAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014804.2-1731s21c1
Sequence:CCCGGATGTATTAGATGCGGATATACTCGAGTATATCCGCATCTAATACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014804.1-204s1c1
Sequence:CCGGCTGCAGTTTAATAGGAATGTTCTCGAGAACATTCCTATTAAACTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014804.1-1173s1c1
Sequence:CCGGCCTGATGTGGTTATAGATATTCTCGAGAATATCTATAACCACATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014804.1-3353s1c1
Sequence:CCGGCGTATATTTCACACAAGGATTCTCGAGAATCCTTGTGTGAAATATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014804.1-2443s1c1
Sequence:CCGGGCCGAATGGAAGAGATGGAAACTCGAGTTTCCATCTCTTCCATTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)