EMAIL THIS PAGE TO A FRIEND

KIAA0754

KIAA0754

25 Gene Product Result for
UniProtKB ID: O94854, E9PMC2, Q6ZSB2
Gene ID:
cow(100140317) KIAA0754 ortholog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301824 ANTI-KIAA0754 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015038 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015038 Rosetta Predictions human pricing
XM_928706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346860 predicted 5085
2 SASI_Hs02_00346861 predicted 1333
3 SASI_Hs02_00346862 predicted 2695
4 SASI_Hs02_00346863 predicted 2953
5 SASI_Hs02_00346864 predicted 3492
6 SASI_Hs02_00346865 predicted 2022
7 SASI_Hs02_00346866 predicted 1916
8 SASI_Hs02_00346867 predicted 1202
9 SASI_Hs02_00346868 predicted 2194
10 SASI_Hs02_00346869 predicted 3410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248691 predicted 4266
2 SASI_Hs01_00248692 predicted 1585
3 SASI_Hs01_00248693 predicted 507
4 SASI_Hs01_00248694 predicted 1880
5 SASI_Hs01_00248695 predicted 2131
6 SASI_Hs01_00248696 predicted 1203
7 SASI_Hs01_00248697 predicted 1105
8 SASI_Hs01_00248698 predicted 1373
9 SASI_Hs01_00248699 predicted 2587
10 SASI_Hs01_00248700 predicted 297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015038
KIAA0754 MISSION shRNA Bacterial Glycerol Stock
KIAA0754
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-2421s21c1
Sequence:CCGGACTTATTGCCCACGTTGATATCTCGAGATATCAACGTGGGCAATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-2761s21c1
Sequence:CCGGCCTGAAGTAGAGGTGTTATATCTCGAGATATAACACCTCTACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-970s21c1
Sequence:CCGGATATCCAGCAATGGTACATTACTCGAGTAATGTACCATTGCTGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-858s21c1
Sequence:CCGGTGTTCCACAACGGTCTATATACTCGAGTATATAGACCGTTGTGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015038.1-5331s21c1
Sequence:CCGGTCATTGGTGGTGTCAACATTTCTCGAGAAATGTTGACACCACCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015038
KIAA0754 MISSION shRNA shRNA Plasmid DNA
KIAA0754
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-2421s21c1
Sequence:CCGGACTTATTGCCCACGTTGATATCTCGAGATATCAACGTGGGCAATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-2761s21c1
Sequence:CCGGCCTGAAGTAGAGGTGTTATATCTCGAGATATAACACCTCTACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-970s21c1
Sequence:CCGGATATCCAGCAATGGTACATTACTCGAGTAATGTACCATTGCTGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-858s21c1
Sequence:CCGGTGTTCCACAACGGTCTATATACTCGAGTATATAGACCGTTGTGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015038.1-5331s21c1
Sequence:CCGGTCATTGGTGGTGTCAACATTTCTCGAGAAATGTTGACACCACCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015038
KIAA0754 MISSION shRNA Lentiviral Transduction Particles
KIAA0754
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-2421s21c1
Sequence:CCGGACTTATTGCCCACGTTGATATCTCGAGATATCAACGTGGGCAATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-2761s21c1
Sequence:CCGGCCTGAAGTAGAGGTGTTATATCTCGAGATATAACACCTCTACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-970s21c1
Sequence:CCGGATATCCAGCAATGGTACATTACTCGAGTAATGTACCATTGCTGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015038.1-858s21c1
Sequence:CCGGTGTTCCACAACGGTCTATATACTCGAGTATATAGACCGTTGTGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015038.1-5331s21c1
Sequence:CCGGTCATTGGTGGTGTCAACATTTCTCGAGAAATGTTGACACCACCAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)